FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623835_at:

>probe:Drosophila_2:1623835_at:247:687; Interrogation_Position=1019; Antisense; TATACGGTTGTGATCGAGGCTATCC
>probe:Drosophila_2:1623835_at:517:315; Interrogation_Position=1048; Antisense; GCCTTCACCAAAGTTGCCTCATATT
>probe:Drosophila_2:1623835_at:51:659; Interrogation_Position=1100; Antisense; TAAGTGCCCACCAGGATACCACGGA
>probe:Drosophila_2:1623835_at:585:281; Interrogation_Position=1121; Antisense; CGGAGGCAATATTTTTCGACCAGTA
>probe:Drosophila_2:1623835_at:365:727; Interrogation_Position=1201; Antisense; TTGGAAGACGATGTGCCCGACGAAC
>probe:Drosophila_2:1623835_at:187:321; Interrogation_Position=1215; Antisense; GCCCGACGAACTAGATGTGCATCCG
>probe:Drosophila_2:1623835_at:258:271; Interrogation_Position=1260; Antisense; CATCTCCGAGAATGTCAGACCGCGA
>probe:Drosophila_2:1623835_at:624:179; Interrogation_Position=753; Antisense; AAACAAACTGGCCATCGCATCTGGT
>probe:Drosophila_2:1623835_at:447:131; Interrogation_Position=793; Antisense; ACCGGAGTCCATGCGATCAGCAATG
>probe:Drosophila_2:1623835_at:10:341; Interrogation_Position=824; Antisense; GCTACGTCCAGCTGCAGATAATCGA
>probe:Drosophila_2:1623835_at:683:717; Interrogation_Position=871; Antisense; TTCCCGCTATCCTATCGAGGTACAA
>probe:Drosophila_2:1623835_at:531:561; Interrogation_Position=914; Antisense; GGAATGCCCGTTCAACTTGCAATGG
>probe:Drosophila_2:1623835_at:129:467; Interrogation_Position=939; Antisense; TGATTCGGGAGGACCTTTGGTTCTC
>probe:Drosophila_2:1623835_at:282:565; Interrogation_Position=997; Antisense; GGAATTACATCCTTTGGCAGCATAT

Paste this into a BLAST search page for me
TATACGGTTGTGATCGAGGCTATCCGCCTTCACCAAAGTTGCCTCATATTTAAGTGCCCACCAGGATACCACGGACGGAGGCAATATTTTTCGACCAGTATTGGAAGACGATGTGCCCGACGAACGCCCGACGAACTAGATGTGCATCCGCATCTCCGAGAATGTCAGACCGCGAAAACAAACTGGCCATCGCATCTGGTACCGGAGTCCATGCGATCAGCAATGGCTACGTCCAGCTGCAGATAATCGATTCCCGCTATCCTATCGAGGTACAAGGAATGCCCGTTCAACTTGCAATGGTGATTCGGGAGGACCTTTGGTTCTCGGAATTACATCCTTTGGCAGCATAT

Full Affymetrix probeset data:

Annotations for 1623835_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720