Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623836_at:

>probe:Drosophila_2:1623836_at:277:223; Interrogation_Position=318; Antisense; AAGGGTGCCGGCATTGGCGCCAACT
>probe:Drosophila_2:1623836_at:565:191; Interrogation_Position=339; Antisense; AACTTCGCCAAGACCATCGGCATTG
>probe:Drosophila_2:1623836_at:353:345; Interrogation_Position=358; Antisense; GCATTGCCGTCGACAGGAGGCGCAA
>probe:Drosophila_2:1623836_at:267:105; Interrogation_Position=382; Antisense; AGAACAAATCCCTGGAGTCCCGCCA
>probe:Drosophila_2:1623836_at:370:121; Interrogation_Position=406; Antisense; AGCGTAACATCCAGCGCCTCAAGGA
>probe:Drosophila_2:1623836_at:30:431; Interrogation_Position=429; Antisense; GAGTACCGCAGCAAGTTGATCCTGT
>probe:Drosophila_2:1623836_at:450:581; Interrogation_Position=511; Antisense; TGGCTACCCAGCTTAAGGGACCCGT
>probe:Drosophila_2:1623836_at:453:131; Interrogation_Position=530; Antisense; ACCCGTCCTGCCCATCAAAAATGAG
>probe:Drosophila_2:1623836_at:33:651; Interrogation_Position=544; Antisense; TCAAAAATGAGCAGCCCGCCGTGGT
>probe:Drosophila_2:1623836_at:395:635; Interrogation_Position=568; Antisense; TCGAGTTCCGTGAGGTGACCAAGGA
>probe:Drosophila_2:1623836_at:569:355; Interrogation_Position=634; Antisense; GCACTGATGCCCGTTTGGTCGGAAT
>probe:Drosophila_2:1623836_at:473:437; Interrogation_Position=693; Antisense; GAGGACGCCGCCAAGGGAGACCCCA
>probe:Drosophila_2:1623836_at:271:203; Interrogation_Position=734; Antisense; AACCACATCTTAACCTGATCGTTCT
>probe:Drosophila_2:1623836_at:337:451; Interrogation_Position=750; Antisense; GATCGTTCTGTCTACAACATCAACC

Paste this into a BLAST search page for me
AAGGGTGCCGGCATTGGCGCCAACTAACTTCGCCAAGACCATCGGCATTGGCATTGCCGTCGACAGGAGGCGCAAAGAACAAATCCCTGGAGTCCCGCCAAGCGTAACATCCAGCGCCTCAAGGAGAGTACCGCAGCAAGTTGATCCTGTTGGCTACCCAGCTTAAGGGACCCGTACCCGTCCTGCCCATCAAAAATGAGTCAAAAATGAGCAGCCCGCCGTGGTTCGAGTTCCGTGAGGTGACCAAGGAGCACTGATGCCCGTTTGGTCGGAATGAGGACGCCGCCAAGGGAGACCCCAAACCACATCTTAACCTGATCGTTCTGATCGTTCTGTCTACAACATCAACC

Full Affymetrix probeset data:

Annotations for 1623836_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime