Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623837_at:

>probe:Drosophila_2:1623837_at:486:527; Interrogation_Position=3942; Antisense; GGGAGTGACACTGACCGCCGATCTT
>probe:Drosophila_2:1623837_at:207:299; Interrogation_Position=3957; Antisense; CGCCGATCTTTTACTGTACACGTTG
>probe:Drosophila_2:1623837_at:461:153; Interrogation_Position=3974; Antisense; ACACGTTGGACCACAATGAGGACCT
>probe:Drosophila_2:1623837_at:412:555; Interrogation_Position=3993; Antisense; GGACCTGGATATACCTCGAGTTATC
>probe:Drosophila_2:1623837_at:660:91; Interrogation_Position=4011; Antisense; AGTTATCGGGCAGCTAAGGCATCAA
>probe:Drosophila_2:1623837_at:705:543; Interrogation_Position=4038; Antisense; GGATAGCATTATACCATCCCTGGCG
>probe:Drosophila_2:1623837_at:337:703; Interrogation_Position=4088; Antisense; TTATTACCTATTTGAAGCGCACGAG
>probe:Drosophila_2:1623837_at:507:205; Interrogation_Position=4102; Antisense; AAGCGCACGAGGCTCATCTGAGGTT
>probe:Drosophila_2:1623837_at:121:165; Interrogation_Position=4221; Antisense; AAATCAGTACAACTCCGTTCAGCAA
>probe:Drosophila_2:1623837_at:351:17; Interrogation_Position=4245; Antisense; ATTTTATATTTCTACTGGCAGCTGT
>probe:Drosophila_2:1623837_at:271:263; Interrogation_Position=4263; Antisense; CAGCTGTTGTCCCTATAATCGTTAA
>probe:Drosophila_2:1623837_at:456:301; Interrogation_Position=4340; Antisense; CCCCACAATGGCCACTTTATAGATA
>probe:Drosophila_2:1623837_at:435:673; Interrogation_Position=4390; Antisense; TAGGTAGTTGTTTTGGCAAGCCAGT
>probe:Drosophila_2:1623837_at:332:49; Interrogation_Position=4419; Antisense; ATGCCAGTTAACTAACCACAGCCAC

Paste this into a BLAST search page for me
GGGAGTGACACTGACCGCCGATCTTCGCCGATCTTTTACTGTACACGTTGACACGTTGGACCACAATGAGGACCTGGACCTGGATATACCTCGAGTTATCAGTTATCGGGCAGCTAAGGCATCAAGGATAGCATTATACCATCCCTGGCGTTATTACCTATTTGAAGCGCACGAGAAGCGCACGAGGCTCATCTGAGGTTAAATCAGTACAACTCCGTTCAGCAAATTTTATATTTCTACTGGCAGCTGTCAGCTGTTGTCCCTATAATCGTTAACCCCACAATGGCCACTTTATAGATATAGGTAGTTGTTTTGGCAAGCCAGTATGCCAGTTAACTAACCACAGCCAC

Full Affymetrix probeset data:

Annotations for 1623837_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime