FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623839_at:

>probe:Drosophila_2:1623839_at:577:433; Interrogation_Position=1026; Antisense; GAGTGGCCATCTTTAGTCAGGGTCA
>probe:Drosophila_2:1623839_at:566:537; Interrogation_Position=1058; Antisense; GGTCAGGTGACTAGTGGCTGCCCAA
>probe:Drosophila_2:1623839_at:92:219; Interrogation_Position=1081; Antisense; AAGTCCCAGTGCTGGACGCAACATT
>probe:Drosophila_2:1623839_at:281:421; Interrogation_Position=1124; Antisense; GAGAATCTAAAAGCACCCGGCACAA
>probe:Drosophila_2:1623839_at:42:339; Interrogation_Position=1174; Antisense; GCTCTACGAGGCTGAAGTCACTAAA
>probe:Drosophila_2:1623839_at:688:457; Interrogation_Position=715; Antisense; GATATCGGTGGCATCCAGCCAGGCA
>probe:Drosophila_2:1623839_at:729:377; Interrogation_Position=742; Antisense; GAAGCTCACTGAATCTCTTCTTGAG
>probe:Drosophila_2:1623839_at:73:83; Interrogation_Position=767; Antisense; AGTGGAGTCCTCAAGCTTGCTGGTC
>probe:Drosophila_2:1623839_at:287:415; Interrogation_Position=795; Antisense; GAGCCAGAGACTCCCTGCGATTGGA
>probe:Drosophila_2:1623839_at:265:463; Interrogation_Position=851; Antisense; GATTCTAAGACGACACCCGTGGAGG
>probe:Drosophila_2:1623839_at:175:465; Interrogation_Position=889; Antisense; GTTGGTAACCAAAAGACGCCGCACA
>probe:Drosophila_2:1623839_at:628:159; Interrogation_Position=911; Antisense; ACAACCCGCGATTTTCCAGGAGCTG
>probe:Drosophila_2:1623839_at:154:611; Interrogation_Position=934; Antisense; TGACGTGATCCTTGGCCAGCTGAAG
>probe:Drosophila_2:1623839_at:646:591; Interrogation_Position=981; Antisense; TGGGTCTCCAGATGTTGGGCACCAA

Paste this into a BLAST search page for me
GAGTGGCCATCTTTAGTCAGGGTCAGGTCAGGTGACTAGTGGCTGCCCAAAAGTCCCAGTGCTGGACGCAACATTGAGAATCTAAAAGCACCCGGCACAAGCTCTACGAGGCTGAAGTCACTAAAGATATCGGTGGCATCCAGCCAGGCAGAAGCTCACTGAATCTCTTCTTGAGAGTGGAGTCCTCAAGCTTGCTGGTCGAGCCAGAGACTCCCTGCGATTGGAGATTCTAAGACGACACCCGTGGAGGGTTGGTAACCAAAAGACGCCGCACAACAACCCGCGATTTTCCAGGAGCTGTGACGTGATCCTTGGCCAGCTGAAGTGGGTCTCCAGATGTTGGGCACCAA

Full Affymetrix probeset data:

Annotations for 1623839_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720