Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623840_at:

>probe:Drosophila_2:1623840_at:43:199; Interrogation_Position=154; Antisense; AACGAGGAGATCAACGACGCCTTCA
>probe:Drosophila_2:1623840_at:153:407; Interrogation_Position=169; Antisense; GACGCCTTCAACCAGTCGATAATCG
>probe:Drosophila_2:1623840_at:564:81; Interrogation_Position=197; Antisense; AGGGCACCAGCCTTTTGGCACTGGA
>probe:Drosophila_2:1623840_at:564:303; Interrogation_Position=237; Antisense; CCGGATTGTGGGTCTAGTTCTGGCA
>probe:Drosophila_2:1623840_at:149:585; Interrogation_Position=257; Antisense; TGGCATGTGCCAGTTATCCCGATAA
>probe:Drosophila_2:1623840_at:176:581; Interrogation_Position=363; Antisense; GGCCAAGCGCGAAGTCAATCTGTTT
>probe:Drosophila_2:1623840_at:703:249; Interrogation_Position=378; Antisense; CAATCTGTTTGAGCGCTACGACATC
>probe:Drosophila_2:1623840_at:12:141; Interrogation_Position=422; Antisense; ACGTGACCAGCGTGGCCTCGTGGAA
>probe:Drosophila_2:1623840_at:724:413; Interrogation_Position=490; Antisense; GAGCTGGGCCGATCGAATGGTTTCC
>probe:Drosophila_2:1623840_at:624:703; Interrogation_Position=518; Antisense; TTATGATGGCCTTCTGCACTAGCTT
>probe:Drosophila_2:1623840_at:533:547; Interrogation_Position=576; Antisense; GGAGTGCATCTATTCCATCGACTAC
>probe:Drosophila_2:1623840_at:594:39; Interrogation_Position=592; Antisense; ATCGACTACGCCGACTATAAGGACG
>probe:Drosophila_2:1623840_at:117:557; Interrogation_Position=622; Antisense; GGACGAGTGATCTTCACACCGGCAG
>probe:Drosophila_2:1623840_at:183:609; Interrogation_Position=96; Antisense; TGAGTACTACACATCGGAGCCTCTG

Paste this into a BLAST search page for me
AACGAGGAGATCAACGACGCCTTCAGACGCCTTCAACCAGTCGATAATCGAGGGCACCAGCCTTTTGGCACTGGACCGGATTGTGGGTCTAGTTCTGGCATGGCATGTGCCAGTTATCCCGATAAGGCCAAGCGCGAAGTCAATCTGTTTCAATCTGTTTGAGCGCTACGACATCACGTGACCAGCGTGGCCTCGTGGAAGAGCTGGGCCGATCGAATGGTTTCCTTATGATGGCCTTCTGCACTAGCTTGGAGTGCATCTATTCCATCGACTACATCGACTACGCCGACTATAAGGACGGGACGAGTGATCTTCACACCGGCAGTGAGTACTACACATCGGAGCCTCTG

Full Affymetrix probeset data:

Annotations for 1623840_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime