FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623841_at:

>probe:Drosophila_2:1623841_at:361:629; Interrogation_Position=1004; Antisense; TCCTTATCTGGAGCATCGGTTTGGT
>probe:Drosophila_2:1623841_at:375:25; Interrogation_Position=458; Antisense; ATATGGATACTTCGGACTCGTCTTC
>probe:Drosophila_2:1623841_at:677:637; Interrogation_Position=475; Antisense; TCGTCTTCAGACTCTTCAGTGACTC
>probe:Drosophila_2:1623841_at:317:635; Interrogation_Position=507; Antisense; TCGCCCATCAACTTCACTAGAGGAG
>probe:Drosophila_2:1623841_at:155:549; Interrogation_Position=528; Antisense; GGAGGTCCTGGAAACTCACCCAACA
>probe:Drosophila_2:1623841_at:635:367; Interrogation_Position=565; Antisense; GAACCAATGGGAGGATCGCCCGATT
>probe:Drosophila_2:1623841_at:581:441; Interrogation_Position=598; Antisense; GATGGGCCCCAGGAGGACACCACAA
>probe:Drosophila_2:1623841_at:555:375; Interrogation_Position=634; Antisense; GAAGAAACAACCTTGGCACCACACA
>probe:Drosophila_2:1623841_at:263:189; Interrogation_Position=680; Antisense; AACAGAAACCCCTAAGCTGCTATTC
>probe:Drosophila_2:1623841_at:495:185; Interrogation_Position=738; Antisense; AACAAAGTCAAACTGCGGCCCGATA
>probe:Drosophila_2:1623841_at:68:67; Interrogation_Position=776; Antisense; ATGGATGTCGCACCATACTGCTCAA
>probe:Drosophila_2:1623841_at:66:25; Interrogation_Position=863; Antisense; ATATGGAGCTATCTCGCTATTGCGC
>probe:Drosophila_2:1623841_at:257:57; Interrogation_Position=893; Antisense; ATGAGAAGCTGTGTCCCACGTGCTA
>probe:Drosophila_2:1623841_at:190:365; Interrogation_Position=949; Antisense; GAATATGAAGTCACTCCGGGCTCTG

Paste this into a BLAST search page for me
TCCTTATCTGGAGCATCGGTTTGGTATATGGATACTTCGGACTCGTCTTCTCGTCTTCAGACTCTTCAGTGACTCTCGCCCATCAACTTCACTAGAGGAGGGAGGTCCTGGAAACTCACCCAACAGAACCAATGGGAGGATCGCCCGATTGATGGGCCCCAGGAGGACACCACAAGAAGAAACAACCTTGGCACCACACAAACAGAAACCCCTAAGCTGCTATTCAACAAAGTCAAACTGCGGCCCGATAATGGATGTCGCACCATACTGCTCAAATATGGAGCTATCTCGCTATTGCGCATGAGAAGCTGTGTCCCACGTGCTAGAATATGAAGTCACTCCGGGCTCTG

Full Affymetrix probeset data:

Annotations for 1623841_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720