FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623843_at:

>probe:Drosophila_2:1623843_at:394:485; Interrogation_Position=1073; Antisense; GTAGTTATCTCTTTTCTTGTTGCCA
>probe:Drosophila_2:1623843_at:127:259; Interrogation_Position=1096; Antisense; CAGAAATAAATTGGCCTCGCGTCCC
>probe:Drosophila_2:1623843_at:616:71; Interrogation_Position=544; Antisense; AGGCAGTGGCCGATCAAGCCGGCAT
>probe:Drosophila_2:1623843_at:201:287; Interrogation_Position=572; Antisense; CGGCCATTACGTGGAAACCGCTAAG
>probe:Drosophila_2:1623843_at:499:87; Interrogation_Position=607; Antisense; AGTCCACCATCGACATGCTGAACGA
>probe:Drosophila_2:1623843_at:145:521; Interrogation_Position=671; Antisense; GGGCGGTCTGGCTGGTTTCATCTTC
>probe:Drosophila_2:1623843_at:171:181; Interrogation_Position=787; Antisense; AAAACTGCCGCGTGGTACTCTACGA
>probe:Drosophila_2:1623843_at:420:63; Interrogation_Position=811; Antisense; AGGGCCGTAAGATCTTCGCCGTGGC
>probe:Drosophila_2:1623843_at:324:571; Interrogation_Position=833; Antisense; GGCCTACAACTTCATCAAGGGCGTA
>probe:Drosophila_2:1623843_at:715:73; Interrogation_Position=863; Antisense; AGGAGAGGATGTTCCCGTAGTGCCC
>probe:Drosophila_2:1623843_at:501:547; Interrogation_Position=902; Antisense; GGAGGACCTTAAGTACATGGCCAGT
>probe:Drosophila_2:1623843_at:331:153; Interrogation_Position=916; Antisense; ACATGGCCAGTGACCTGTACGATGA
>probe:Drosophila_2:1623843_at:216:567; Interrogation_Position=941; Antisense; GGCAAAGGATCTAATCTTCCCCAAA
>probe:Drosophila_2:1623843_at:472:209; Interrogation_Position=966; Antisense; AAGAAGTAGGAAGTGCCCTCCCGCT

Paste this into a BLAST search page for me
GTAGTTATCTCTTTTCTTGTTGCCACAGAAATAAATTGGCCTCGCGTCCCAGGCAGTGGCCGATCAAGCCGGCATCGGCCATTACGTGGAAACCGCTAAGAGTCCACCATCGACATGCTGAACGAGGGCGGTCTGGCTGGTTTCATCTTCAAAACTGCCGCGTGGTACTCTACGAAGGGCCGTAAGATCTTCGCCGTGGCGGCCTACAACTTCATCAAGGGCGTAAGGAGAGGATGTTCCCGTAGTGCCCGGAGGACCTTAAGTACATGGCCAGTACATGGCCAGTGACCTGTACGATGAGGCAAAGGATCTAATCTTCCCCAAAAAGAAGTAGGAAGTGCCCTCCCGCT

Full Affymetrix probeset data:

Annotations for 1623843_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720