Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623844_at:

>probe:Drosophila_2:1623844_at:366:565; Interrogation_Position=1007; Antisense; GGAATCACCACCTCAGAAAAACTCA
>probe:Drosophila_2:1623844_at:64:179; Interrogation_Position=1025; Antisense; AAACTCAGGGACACCTCAGACACGG
>probe:Drosophila_2:1623844_at:672:105; Interrogation_Position=1042; Antisense; AGACACGGCCCTGTAAATCGCGCTT
>probe:Drosophila_2:1623844_at:7:237; Interrogation_Position=1057; Antisense; AATCGCGCTTATCCAAAACACAACA
>probe:Drosophila_2:1623844_at:138:159; Interrogation_Position=1074; Antisense; ACACAACATGGCATCAGGAGGCATT
>probe:Drosophila_2:1623844_at:57:551; Interrogation_Position=1099; Antisense; GGAGATTCAGTTTCATTTTCATTCA
>probe:Drosophila_2:1623844_at:359:105; Interrogation_Position=652; Antisense; AGACTTGTGGCATATACTTTCGAAA
>probe:Drosophila_2:1623844_at:539:409; Interrogation_Position=677; Antisense; GACCGTAACACAATATTCACACCTA
>probe:Drosophila_2:1623844_at:241:165; Interrogation_Position=736; Antisense; AAATCTTATCCCAGGCAACATACTC
>probe:Drosophila_2:1623844_at:493:661; Interrogation_Position=834; Antisense; TAAAACATGGCGCAAGGACACACTC
>probe:Drosophila_2:1623844_at:443:559; Interrogation_Position=849; Antisense; GGACACACTCGCATACTTGCAGGAA
>probe:Drosophila_2:1623844_at:578:345; Interrogation_Position=859; Antisense; GCATACTTGCAGGAAACCCCGGAAA
>probe:Drosophila_2:1623844_at:237:613; Interrogation_Position=900; Antisense; TGAAAATTCCGACCTACCGCAATAA
>probe:Drosophila_2:1623844_at:348:433; Interrogation_Position=962; Antisense; GAGTGAAATGGCCAGCTCACACACA

Paste this into a BLAST search page for me
GGAATCACCACCTCAGAAAAACTCAAAACTCAGGGACACCTCAGACACGGAGACACGGCCCTGTAAATCGCGCTTAATCGCGCTTATCCAAAACACAACAACACAACATGGCATCAGGAGGCATTGGAGATTCAGTTTCATTTTCATTCAAGACTTGTGGCATATACTTTCGAAAGACCGTAACACAATATTCACACCTAAAATCTTATCCCAGGCAACATACTCTAAAACATGGCGCAAGGACACACTCGGACACACTCGCATACTTGCAGGAAGCATACTTGCAGGAAACCCCGGAAATGAAAATTCCGACCTACCGCAATAAGAGTGAAATGGCCAGCTCACACACA

Full Affymetrix probeset data:

Annotations for 1623844_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime