Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623846_at:

>probe:Drosophila_2:1623846_at:512:387; Interrogation_Position=4102; Antisense; GAAAATGCATTGCTCATGCTCACAT
>probe:Drosophila_2:1623846_at:624:337; Interrogation_Position=4113; Antisense; GCTCATGCTCACATCGAGGATCGAA
>probe:Drosophila_2:1623846_at:262:77; Interrogation_Position=4129; Antisense; AGGATCGAAGATCGTCTGCCGCTCA
>probe:Drosophila_2:1623846_at:161:451; Interrogation_Position=4138; Antisense; GATCGTCTGCCGCTCATAAATACGA
>probe:Drosophila_2:1623846_at:102:163; Interrogation_Position=4163; Antisense; AAATACTTTCACTTAGGCTAATGCT
>probe:Drosophila_2:1623846_at:380:249; Interrogation_Position=4360; Antisense; CAAGTACGTCGTGTTGTAGAGAATT
>probe:Drosophila_2:1623846_at:613:455; Interrogation_Position=4428; Antisense; GATACATATTGTTAGTGATACTCGA
>probe:Drosophila_2:1623846_at:470:709; Interrogation_Position=4462; Antisense; TTAAGTAGCCTCTAAGCAGCGCCTA
>probe:Drosophila_2:1623846_at:538:353; Interrogation_Position=4477; Antisense; GCAGCGCCTACTGGTATCGTGAGTA
>probe:Drosophila_2:1623846_at:209:431; Interrogation_Position=4605; Antisense; GAGTCAACCAACGACGAAACGCTTG
>probe:Drosophila_2:1623846_at:11:175; Interrogation_Position=4621; Antisense; AAACGCTTGATATGAGGAAACGAAC
>probe:Drosophila_2:1623846_at:31:699; Interrogation_Position=4651; Antisense; TTGATTACAGATTGCCGTTTACCGA
>probe:Drosophila_2:1623846_at:155:265; Interrogation_Position=4658; Antisense; CAGATTGCCGTTTACCGAACTGGGT
>probe:Drosophila_2:1623846_at:495:303; Interrogation_Position=4672; Antisense; CCGAACTGGGTTAGGATCACTCATT

Paste this into a BLAST search page for me
GAAAATGCATTGCTCATGCTCACATGCTCATGCTCACATCGAGGATCGAAAGGATCGAAGATCGTCTGCCGCTCAGATCGTCTGCCGCTCATAAATACGAAAATACTTTCACTTAGGCTAATGCTCAAGTACGTCGTGTTGTAGAGAATTGATACATATTGTTAGTGATACTCGATTAAGTAGCCTCTAAGCAGCGCCTAGCAGCGCCTACTGGTATCGTGAGTAGAGTCAACCAACGACGAAACGCTTGAAACGCTTGATATGAGGAAACGAACTTGATTACAGATTGCCGTTTACCGACAGATTGCCGTTTACCGAACTGGGTCCGAACTGGGTTAGGATCACTCATT

Full Affymetrix probeset data:

Annotations for 1623846_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime