Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623847_at:

>probe:Drosophila_2:1623847_at:100:375; Interrogation_Position=1726; Antisense; GAAGAGTTTGAGTTGCAGCACCAGT
>probe:Drosophila_2:1623847_at:537:91; Interrogation_Position=1748; Antisense; AGTTAGATCGGCATTTCCAGCTGCA
>probe:Drosophila_2:1623847_at:331:245; Interrogation_Position=1786; Antisense; AATTACCACTGCAATTTCTGCCGAT
>probe:Drosophila_2:1623847_at:201:641; Interrogation_Position=1802; Antisense; TCTGCCGATTGGAGTTTCTTAGCGA
>probe:Drosophila_2:1623847_at:178:725; Interrogation_Position=1892; Antisense; TTGATCGTTCGCTCTCGATTGTCAA
>probe:Drosophila_2:1623847_at:362:5; Interrogation_Position=1909; Antisense; ATTGTCAACTGCCATGTGCCACGGT
>probe:Drosophila_2:1623847_at:393:259; Interrogation_Position=1928; Antisense; CACGGTCATCGGACTATTCTCGAAT
>probe:Drosophila_2:1623847_at:449:383; Interrogation_Position=1969; Antisense; GAACGTGAGTTCTATATTCCGCGAA
>probe:Drosophila_2:1623847_at:366:303; Interrogation_Position=2083; Antisense; CCGAACTGCGTTGGATGTCACTGAT
>probe:Drosophila_2:1623847_at:553:135; Interrogation_Position=2109; Antisense; ACGAACTTGTTGTGAGCTCCATTCT
>probe:Drosophila_2:1623847_at:391:337; Interrogation_Position=2124; Antisense; GCTCCATTCTTCGTCTGCAATATAT
>probe:Drosophila_2:1623847_at:347:363; Interrogation_Position=2151; Antisense; GAATAGGTCATGCTACACGTTACTA
>probe:Drosophila_2:1623847_at:467:339; Interrogation_Position=2190; Antisense; GCTAATATGCACACTCTTTGGTCGA
>probe:Drosophila_2:1623847_at:250:635; Interrogation_Position=2227; Antisense; TCGACTATTGCGTTCTCTTTGTATA

Paste this into a BLAST search page for me
GAAGAGTTTGAGTTGCAGCACCAGTAGTTAGATCGGCATTTCCAGCTGCAAATTACCACTGCAATTTCTGCCGATTCTGCCGATTGGAGTTTCTTAGCGATTGATCGTTCGCTCTCGATTGTCAAATTGTCAACTGCCATGTGCCACGGTCACGGTCATCGGACTATTCTCGAATGAACGTGAGTTCTATATTCCGCGAACCGAACTGCGTTGGATGTCACTGATACGAACTTGTTGTGAGCTCCATTCTGCTCCATTCTTCGTCTGCAATATATGAATAGGTCATGCTACACGTTACTAGCTAATATGCACACTCTTTGGTCGATCGACTATTGCGTTCTCTTTGTATA

Full Affymetrix probeset data:

Annotations for 1623847_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime