FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623851_at:

>probe:Drosophila_2:1623851_at:556:717; Interrogation_Position=549; Antisense; TTCGCGACGCATGAAATCCTTCGTG
>probe:Drosophila_2:1623851_at:589:225; Interrogation_Position=563; Antisense; AATCCTTCGTGATCAACTGGTTCCG
>probe:Drosophila_2:1623851_at:13:591; Interrogation_Position=580; Antisense; TGGTTCCGCGAACATCAGGATGCCA
>probe:Drosophila_2:1623851_at:344:311; Interrogation_Position=601; Antisense; GCCAATCAGAGCTTCATCGATAGAT
>probe:Drosophila_2:1623851_at:545:23; Interrogation_Position=620; Antisense; ATAGATATCATCCACATCCGCAAGG
>probe:Drosophila_2:1623851_at:553:537; Interrogation_Position=655; Antisense; GGTCACTTCACATTACTTGTTTCGG
>probe:Drosophila_2:1623851_at:509:545; Interrogation_Position=678; Antisense; GGATCGAGTTAATCGCGTCGGCTGT
>probe:Drosophila_2:1623851_at:540:533; Interrogation_Position=706; Antisense; GGTGTCCGTTTCCTGGAGCCCAAAT
>probe:Drosophila_2:1623851_at:166:237; Interrogation_Position=733; Antisense; AATCGCTTCCAGTTCATGTTGACGT
>probe:Drosophila_2:1623851_at:376:15; Interrogation_Position=778; Antisense; ATTTTCAACGAACCCATCTACCAAT
>probe:Drosophila_2:1623851_at:86:39; Interrogation_Position=793; Antisense; ATCTACCAATCTGGTCCGGCGGGAT
>probe:Drosophila_2:1623851_at:468:35; Interrogation_Position=838; Antisense; ATCAGCGAAAAGTTCCCCAGCTTGT
>probe:Drosophila_2:1623851_at:3:625; Interrogation_Position=862; Antisense; TGCGACTGGCGGGATGCTAACAATG
>probe:Drosophila_2:1623851_at:559:659; Interrogation_Position=970; Antisense; TAAAACTAATACTCGTGGAGCCCCA

Paste this into a BLAST search page for me
TTCGCGACGCATGAAATCCTTCGTGAATCCTTCGTGATCAACTGGTTCCGTGGTTCCGCGAACATCAGGATGCCAGCCAATCAGAGCTTCATCGATAGATATAGATATCATCCACATCCGCAAGGGGTCACTTCACATTACTTGTTTCGGGGATCGAGTTAATCGCGTCGGCTGTGGTGTCCGTTTCCTGGAGCCCAAATAATCGCTTCCAGTTCATGTTGACGTATTTTCAACGAACCCATCTACCAATATCTACCAATCTGGTCCGGCGGGATATCAGCGAAAAGTTCCCCAGCTTGTTGCGACTGGCGGGATGCTAACAATGTAAAACTAATACTCGTGGAGCCCCA

Full Affymetrix probeset data:

Annotations for 1623851_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720