FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623852_at:

>probe:Drosophila_2:1623852_at:1:523; Interrogation_Position=343; Antisense; GGGCCATATATTTGCACTCAGTGTA
>probe:Drosophila_2:1623852_at:211:73; Interrogation_Position=386; Antisense; AGGCATCTCAAAGCACACGGTCAAT
>probe:Drosophila_2:1623852_at:233:57; Interrogation_Position=409; Antisense; ATGAGCTGCGTCTGGAGCCTTCAAA
>probe:Drosophila_2:1623852_at:550:215; Interrogation_Position=438; Antisense; AAGTTCATTTTGTCTCTGACCTTCC
>probe:Drosophila_2:1623852_at:172:611; Interrogation_Position=454; Antisense; TGACCTTCCCAAAGCTGCATATGGA
>probe:Drosophila_2:1623852_at:603:519; Interrogation_Position=543; Antisense; GTGGATCTCGTTAACATCACCATGC
>probe:Drosophila_2:1623852_at:407:35; Interrogation_Position=558; Antisense; ATCACCATGCGAACCGAGCTGATTG
>probe:Drosophila_2:1623852_at:446:137; Interrogation_Position=643; Antisense; ACGAGCTATCTGATGTCCACATTCA
>probe:Drosophila_2:1623852_at:512:645; Interrogation_Position=665; Antisense; TCATCTGGATAACCTTTTCAACGGG
>probe:Drosophila_2:1623852_at:85:257; Interrogation_Position=692; Antisense; CAAAGCTTTGGGTGATCGCATGAAC
>probe:Drosophila_2:1623852_at:586:219; Interrogation_Position=754; Antisense; AAGTGCGTCCGTTGATGACCAAGGC
>probe:Drosophila_2:1623852_at:99:609; Interrogation_Position=769; Antisense; TGACCAAGGCGCTGGTGGACATTTT
>probe:Drosophila_2:1623852_at:235:433; Interrogation_Position=794; Antisense; GAGGGCCTCCGTGGATAAATTGTTT
>probe:Drosophila_2:1623852_at:298:671; Interrogation_Position=831; Antisense; TACGATGATCTGCTTCCCATGTAAA

Paste this into a BLAST search page for me
GGGCCATATATTTGCACTCAGTGTAAGGCATCTCAAAGCACACGGTCAATATGAGCTGCGTCTGGAGCCTTCAAAAAGTTCATTTTGTCTCTGACCTTCCTGACCTTCCCAAAGCTGCATATGGAGTGGATCTCGTTAACATCACCATGCATCACCATGCGAACCGAGCTGATTGACGAGCTATCTGATGTCCACATTCATCATCTGGATAACCTTTTCAACGGGCAAAGCTTTGGGTGATCGCATGAACAAGTGCGTCCGTTGATGACCAAGGCTGACCAAGGCGCTGGTGGACATTTTGAGGGCCTCCGTGGATAAATTGTTTTACGATGATCTGCTTCCCATGTAAA

Full Affymetrix probeset data:

Annotations for 1623852_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720