FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623853_at:

>probe:Drosophila_2:1623853_at:597:515; Interrogation_Position=1186; Antisense; GTGTAAGCTCTGCATTCAAGCAACA
>probe:Drosophila_2:1623853_at:281:111; Interrogation_Position=1204; Antisense; AGCAACAACTCCACCTGTCAAAGGG
>probe:Drosophila_2:1623853_at:600:501; Interrogation_Position=1230; Antisense; GTCGAGGCGACATCCACAACAACTA
>probe:Drosophila_2:1623853_at:347:145; Interrogation_Position=1251; Antisense; ACTACCTCTAACTCGCCATTAATTT
>probe:Drosophila_2:1623853_at:696:1; Interrogation_Position=1340; Antisense; ATTGGCCACATTTTAGCCACGCTTT
>probe:Drosophila_2:1623853_at:110:261; Interrogation_Position=1357; Antisense; CACGCTTTTTATGCCCTTGCAGTTA
>probe:Drosophila_2:1623853_at:698:437; Interrogation_Position=1421; Antisense; GAGGCATTTGCGACCATATAAACTA
>probe:Drosophila_2:1623853_at:169:687; Interrogation_Position=1444; Antisense; TATATATCAGTATCACCAGCGGAGT
>probe:Drosophila_2:1623853_at:109:129; Interrogation_Position=1458; Antisense; ACCAGCGGAGTCGATACGGCCATGT
>probe:Drosophila_2:1623853_at:129:633; Interrogation_Position=1482; Antisense; TCCGTCTGTCAGTTTCTATGCCAAA
>probe:Drosophila_2:1623853_at:377:675; Interrogation_Position=1520; Antisense; TAGCAATCTGCATGAACGGGTCGTT
>probe:Drosophila_2:1623853_at:402:529; Interrogation_Position=1580; Antisense; GGGTATATAAGTTTCGGCTTGCCGA
>probe:Drosophila_2:1623853_at:634:625; Interrogation_Position=1599; Antisense; TGCCGATTCTAGCTTACTTTCTGGT
>probe:Drosophila_2:1623853_at:4:15; Interrogation_Position=1742; Antisense; ATTAAAGCGTCCCATGCTGAGGCAT

Paste this into a BLAST search page for me
GTGTAAGCTCTGCATTCAAGCAACAAGCAACAACTCCACCTGTCAAAGGGGTCGAGGCGACATCCACAACAACTAACTACCTCTAACTCGCCATTAATTTATTGGCCACATTTTAGCCACGCTTTCACGCTTTTTATGCCCTTGCAGTTAGAGGCATTTGCGACCATATAAACTATATATATCAGTATCACCAGCGGAGTACCAGCGGAGTCGATACGGCCATGTTCCGTCTGTCAGTTTCTATGCCAAATAGCAATCTGCATGAACGGGTCGTTGGGTATATAAGTTTCGGCTTGCCGATGCCGATTCTAGCTTACTTTCTGGTATTAAAGCGTCCCATGCTGAGGCAT

Full Affymetrix probeset data:

Annotations for 1623853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720