FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623856_at:

>probe:Drosophila_2:1623856_at:208:229; Interrogation_Position=122; Antisense; AATGGAAGCTGCCTTATTCCAACCC
>probe:Drosophila_2:1623856_at:250:691; Interrogation_Position=162; Antisense; TATTGCCCTGTTTGAAAAACCTTCA
>probe:Drosophila_2:1623856_at:166:197; Interrogation_Position=247; Antisense; AACGGAAGATGGTGCTACTATCGGA
>probe:Drosophila_2:1623856_at:238:339; Interrogation_Position=260; Antisense; GCTACTATCGGAGAAAGCCATTCTA
>probe:Drosophila_2:1623856_at:13:387; Interrogation_Position=290; Antisense; GAAAAGCCTAATCTTTCTATCAAAG
>probe:Drosophila_2:1623856_at:32:459; Interrogation_Position=362; Antisense; GATTTAAATCCGACCGTCCCTAATG
>probe:Drosophila_2:1623856_at:501:631; Interrogation_Position=370; Antisense; TCCGACCGTCCCTAATGCAAATAAA
>probe:Drosophila_2:1623856_at:433:171; Interrogation_Position=392; Antisense; AAAGTGCCTACTGATAGTTCGGAAA
>probe:Drosophila_2:1623856_at:33:241; Interrogation_Position=416; Antisense; AATACCTTAGATTCGGAACCCAATG
>probe:Drosophila_2:1623856_at:609:51; Interrogation_Position=438; Antisense; ATGACAATTTTGTTGGTAAGCCCGA
>probe:Drosophila_2:1623856_at:293:533; Interrogation_Position=452; Antisense; GGTAAGCCCGAAGACTCCAATCAAA
>probe:Drosophila_2:1623856_at:395:543; Interrogation_Position=490; Antisense; GGATATTATAACACCGAGTCAACAT
>probe:Drosophila_2:1623856_at:532:395; Interrogation_Position=610; Antisense; GACAATTTCGGAAGATTCCCAAGTA
>probe:Drosophila_2:1623856_at:718:223; Interrogation_Position=654; Antisense; AAGGAGCATTTCAAGGCGATAATAC

Paste this into a BLAST search page for me
AATGGAAGCTGCCTTATTCCAACCCTATTGCCCTGTTTGAAAAACCTTCAAACGGAAGATGGTGCTACTATCGGAGCTACTATCGGAGAAAGCCATTCTAGAAAAGCCTAATCTTTCTATCAAAGGATTTAAATCCGACCGTCCCTAATGTCCGACCGTCCCTAATGCAAATAAAAAAGTGCCTACTGATAGTTCGGAAAAATACCTTAGATTCGGAACCCAATGATGACAATTTTGTTGGTAAGCCCGAGGTAAGCCCGAAGACTCCAATCAAAGGATATTATAACACCGAGTCAACATGACAATTTCGGAAGATTCCCAAGTAAAGGAGCATTTCAAGGCGATAATAC

Full Affymetrix probeset data:

Annotations for 1623856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720