Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623857_at:

>probe:Drosophila_2:1623857_at:426:165; Interrogation_Position=3042; Antisense; AAATCAGTGGTCGATGTCACGTCCA
>probe:Drosophila_2:1623857_at:598:495; Interrogation_Position=3057; Antisense; GTCACGTCCATTACTGGTTCTCATA
>probe:Drosophila_2:1623857_at:711:57; Interrogation_Position=3089; Antisense; ATGAGGACTATTACCGATCGTTGAA
>probe:Drosophila_2:1623857_at:578:155; Interrogation_Position=3116; Antisense; ACAGAATTATCTGCGCTCAACCAAT
>probe:Drosophila_2:1623857_at:629:67; Interrogation_Position=3157; Antisense; ATGGCGCAATGGTTCGATGATCTAA
>probe:Drosophila_2:1623857_at:369:243; Interrogation_Position=3235; Antisense; AATATGTCAACATTTCGGCGCGATG
>probe:Drosophila_2:1623857_at:291:323; Interrogation_Position=3252; Antisense; GCGCGATGTAGTCAACTTGCCAAAG
>probe:Drosophila_2:1623857_at:668:721; Interrogation_Position=3268; Antisense; TTGCCAAAGTCCACAGCAGCGTTTT
>probe:Drosophila_2:1623857_at:245:353; Interrogation_Position=3283; Antisense; GCAGCGTTTTCGTGTGATCGACCAA
>probe:Drosophila_2:1623857_at:156:451; Interrogation_Position=3298; Antisense; GATCGACCAATGTGCGACGGTGGAT
>probe:Drosophila_2:1623857_at:149:543; Interrogation_Position=3319; Antisense; GGATTCGAACCCAGTGAGCCTGAGT
>probe:Drosophila_2:1623857_at:48:609; Interrogation_Position=3339; Antisense; TGAGTCCTCGCCACATTAGTGCTAA
>probe:Drosophila_2:1623857_at:722:417; Interrogation_Position=3377; Antisense; GAGCATTGGTGGTTATTCGATTGAA
>probe:Drosophila_2:1623857_at:650:211; Interrogation_Position=3460; Antisense; AAGACTATCTATAAGCGACTCGGAG

Paste this into a BLAST search page for me
AAATCAGTGGTCGATGTCACGTCCAGTCACGTCCATTACTGGTTCTCATAATGAGGACTATTACCGATCGTTGAAACAGAATTATCTGCGCTCAACCAATATGGCGCAATGGTTCGATGATCTAAAATATGTCAACATTTCGGCGCGATGGCGCGATGTAGTCAACTTGCCAAAGTTGCCAAAGTCCACAGCAGCGTTTTGCAGCGTTTTCGTGTGATCGACCAAGATCGACCAATGTGCGACGGTGGATGGATTCGAACCCAGTGAGCCTGAGTTGAGTCCTCGCCACATTAGTGCTAAGAGCATTGGTGGTTATTCGATTGAAAAGACTATCTATAAGCGACTCGGAG

Full Affymetrix probeset data:

Annotations for 1623857_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime