FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623858_at:

>probe:Drosophila_2:1623858_at:114:527; Interrogation_Position=188; Antisense; GGGCAATCAACACGTCGCCGAAGAA
>probe:Drosophila_2:1623858_at:92:111; Interrogation_Position=209; Antisense; AGAAGGATGAGACCATCACGGCCCC
>probe:Drosophila_2:1623858_at:599:147; Interrogation_Position=240; Antisense; ACTTACGACCGAGGACTTTGCCAAT
>probe:Drosophila_2:1623858_at:396:719; Interrogation_Position=257; Antisense; TTGCCAATCCGAGTCCCAAGAACTG
>probe:Drosophila_2:1623858_at:682:195; Interrogation_Position=277; Antisense; AACTGGCAGAGCTACGGATTCGACT
>probe:Drosophila_2:1623858_at:291:41; Interrogation_Position=290; Antisense; ACGGATTCGACTACAAGGACCAGGT
>probe:Drosophila_2:1623858_at:532:361; Interrogation_Position=323; Antisense; GCAAGGCCACCAAGTCGACGTTCTT
>probe:Drosophila_2:1623858_at:312:405; Interrogation_Position=339; Antisense; GACGTTCTTCGTTACGGTGACACTG
>probe:Drosophila_2:1623858_at:668:327; Interrogation_Position=470; Antisense; GCGTGGATTTGGTCAGCCCCAACTA
>probe:Drosophila_2:1623858_at:539:705; Interrogation_Position=566; Antisense; TTAGTGACCCTAAACTTAGTCTGTT
>probe:Drosophila_2:1623858_at:82:233; Interrogation_Position=595; Antisense; AATGCGAATGCGAAGTGCGGTCAGT
>probe:Drosophila_2:1623858_at:476:431; Interrogation_Position=622; Antisense; GAGTCCGCTCATAATCCGTTAATAA
>probe:Drosophila_2:1623858_at:325:31; Interrogation_Position=643; Antisense; ATAAATCTGCAAGTCTCGCCGTGGA
>probe:Drosophila_2:1623858_at:442:403; Interrogation_Position=85; Antisense; GACTGAAATTTCTTCCCCAACGCGA

Paste this into a BLAST search page for me
GGGCAATCAACACGTCGCCGAAGAAAGAAGGATGAGACCATCACGGCCCCACTTACGACCGAGGACTTTGCCAATTTGCCAATCCGAGTCCCAAGAACTGAACTGGCAGAGCTACGGATTCGACTACGGATTCGACTACAAGGACCAGGTGCAAGGCCACCAAGTCGACGTTCTTGACGTTCTTCGTTACGGTGACACTGGCGTGGATTTGGTCAGCCCCAACTATTAGTGACCCTAAACTTAGTCTGTTAATGCGAATGCGAAGTGCGGTCAGTGAGTCCGCTCATAATCCGTTAATAAATAAATCTGCAAGTCTCGCCGTGGAGACTGAAATTTCTTCCCCAACGCGA

Full Affymetrix probeset data:

Annotations for 1623858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720