FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623859_at:

>probe:Drosophila_2:1623859_at:564:339; Interrogation_Position=142; Antisense; GCTAAGCCAGCTTACCAGGCAAATA
>probe:Drosophila_2:1623859_at:485:567; Interrogation_Position=178; Antisense; GGCACTTATGTCCAGTTTTCGTTCA
>probe:Drosophila_2:1623859_at:405:473; Interrogation_Position=198; Antisense; GTTCATCCCGCGAAGTTCAGGAGCT
>probe:Drosophila_2:1623859_at:506:727; Interrogation_Position=273; Antisense; TTGTGGAGCGCTTGCTACCAGCGAA
>probe:Drosophila_2:1623859_at:423:593; Interrogation_Position=372; Antisense; TGGGTTACCATGTGGCCAGGACGAA
>probe:Drosophila_2:1623859_at:384:111; Interrogation_Position=396; Antisense; AGAATCACATGGTGCCCGTGTATCT
>probe:Drosophila_2:1623859_at:179:601; Interrogation_Position=414; Antisense; TGTATCTGCACACCAGGTTCCGTGG
>probe:Drosophila_2:1623859_at:285:507; Interrogation_Position=458; Antisense; GTGCGACGCGTCCAAGGAGACATTT
>probe:Drosophila_2:1623859_at:639:223; Interrogation_Position=533; Antisense; AAGGTCTGCGCCACGAGAATCAATG
>probe:Drosophila_2:1623859_at:426:609; Interrogation_Position=561; Antisense; TGAGCGGTCAGATACACTTCCATGG
>probe:Drosophila_2:1623859_at:524:149; Interrogation_Position=576; Antisense; ACTTCCATGGTGACCACGTGGACGT
>probe:Drosophila_2:1623859_at:362:139; Interrogation_Position=597; Antisense; ACGTCCTGCGTGACTATCTCAAGGA
>probe:Drosophila_2:1623859_at:679:81; Interrogation_Position=624; Antisense; AGGGCTTCTGAAGGTCCACAAATGA
>probe:Drosophila_2:1623859_at:566:167; Interrogation_Position=643; Antisense; AAATGAACCGTCTGTGCCGCAATAA

Paste this into a BLAST search page for me
GCTAAGCCAGCTTACCAGGCAAATAGGCACTTATGTCCAGTTTTCGTTCAGTTCATCCCGCGAAGTTCAGGAGCTTTGTGGAGCGCTTGCTACCAGCGAATGGGTTACCATGTGGCCAGGACGAAAGAATCACATGGTGCCCGTGTATCTTGTATCTGCACACCAGGTTCCGTGGGTGCGACGCGTCCAAGGAGACATTTAAGGTCTGCGCCACGAGAATCAATGTGAGCGGTCAGATACACTTCCATGGACTTCCATGGTGACCACGTGGACGTACGTCCTGCGTGACTATCTCAAGGAAGGGCTTCTGAAGGTCCACAAATGAAAATGAACCGTCTGTGCCGCAATAA

Full Affymetrix probeset data:

Annotations for 1623859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720