Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623860_at:

>probe:Drosophila_2:1623860_at:620:447; Interrogation_Position=1290; Antisense; GATGCCATCAATCTGTGCGCCAATG
>probe:Drosophila_2:1623860_at:220:513; Interrogation_Position=1347; Antisense; GTGACCACCAGCACATTGGGCAACA
>probe:Drosophila_2:1623860_at:162:267; Interrogation_Position=1430; Antisense; CAGTACGGCTGCTAATCTTTCGGCA
>probe:Drosophila_2:1623860_at:374:335; Interrogation_Position=1470; Antisense; GCTGCAGCTGCAAACTTATCGAAAT
>probe:Drosophila_2:1623860_at:82:43; Interrogation_Position=1493; Antisense; ATCGGGCGCCAGCTATATGTTGCAA
>probe:Drosophila_2:1623860_at:513:627; Interrogation_Position=1522; Antisense; TGCCACGCCTTTACAGTCAGTTTGC
>probe:Drosophila_2:1623860_at:557:367; Interrogation_Position=1593; Antisense; GAATCGGCATCGGTTAGTGCCTCAC
>probe:Drosophila_2:1623860_at:37:641; Interrogation_Position=1620; Antisense; TCGGCACCCGATCTTTGCGATGAAG
>probe:Drosophila_2:1623860_at:142:163; Interrogation_Position=1658; Antisense; AAATTCCAGTGATACGGGTGCCGGT
>probe:Drosophila_2:1623860_at:180:563; Interrogation_Position=1689; Antisense; GGAACGAGCGGCAATCAGGGCAATT
>probe:Drosophila_2:1623860_at:500:5; Interrogation_Position=1734; Antisense; ATTGACTCCATCAAGTATCGCACGG
>probe:Drosophila_2:1623860_at:279:295; Interrogation_Position=1763; Antisense; CGAGAGCAGTCGATGTTCCAGCAAT
>probe:Drosophila_2:1623860_at:24:471; Interrogation_Position=1777; Antisense; GTTCCAGCAATGACGAGGCTTCCAT
>probe:Drosophila_2:1623860_at:13:71; Interrogation_Position=1792; Antisense; AGGCTTCCATCACGCAAATCGATTG

Paste this into a BLAST search page for me
GATGCCATCAATCTGTGCGCCAATGGTGACCACCAGCACATTGGGCAACACAGTACGGCTGCTAATCTTTCGGCAGCTGCAGCTGCAAACTTATCGAAATATCGGGCGCCAGCTATATGTTGCAATGCCACGCCTTTACAGTCAGTTTGCGAATCGGCATCGGTTAGTGCCTCACTCGGCACCCGATCTTTGCGATGAAGAAATTCCAGTGATACGGGTGCCGGTGGAACGAGCGGCAATCAGGGCAATTATTGACTCCATCAAGTATCGCACGGCGAGAGCAGTCGATGTTCCAGCAATGTTCCAGCAATGACGAGGCTTCCATAGGCTTCCATCACGCAAATCGATTG

Full Affymetrix probeset data:

Annotations for 1623860_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime