FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623861_at:

>probe:Drosophila_2:1623861_at:708:269; Interrogation_Position=1012; Antisense; CATACGGATACAGCGGCGTGTTCTC
>probe:Drosophila_2:1623861_at:280:329; Interrogation_Position=1027; Antisense; GCGTGTTCTCCTTCTACATTAAGGG
>probe:Drosophila_2:1623861_at:106:711; Interrogation_Position=1045; Antisense; TTAAGGGCGAGCTGAAGCACTCCTC
>probe:Drosophila_2:1623861_at:646:221; Interrogation_Position=1089; Antisense; AAGGTGTTCACCCTGGCAGAGAGTC
>probe:Drosophila_2:1623861_at:339:641; Interrogation_Position=1130; Antisense; TCTGGCCGAGCTTCCATCAATAATG
>probe:Drosophila_2:1623861_at:291:653; Interrogation_Position=1146; Antisense; TCAATAATGACCCATGCCTCGGTTC
>probe:Drosophila_2:1623861_at:378:161; Interrogation_Position=1185; Antisense; AAAACTTTGGGCATCACTGACGGTC
>probe:Drosophila_2:1623861_at:129:419; Interrogation_Position=1263; Antisense; GAGCAGGCCCTTGAAATTGCATCGA
>probe:Drosophila_2:1623861_at:479:369; Interrogation_Position=1286; Antisense; GAAGGCCTAAGTTACTCGCATCACA
>probe:Drosophila_2:1623861_at:147:643; Interrogation_Position=834; Antisense; TCTCCATTCGACTGCTATCAGGTGA
>probe:Drosophila_2:1623861_at:629:109; Interrogation_Position=861; Antisense; AGAAGTCTTAAGACGCTCTCGCTGC
>probe:Drosophila_2:1623861_at:586:209; Interrogation_Position=903; Antisense; AAGAATGCTCTGAAGGTTGCCAAAT
>probe:Drosophila_2:1623861_at:78:423; Interrogation_Position=951; Antisense; GAGAAGGTGTTGCATCCCTCTTTGC
>probe:Drosophila_2:1623861_at:282:47; Interrogation_Position=982; Antisense; ATCCGCAGCACAAGATCGCTCTGAA

Paste this into a BLAST search page for me
CATACGGATACAGCGGCGTGTTCTCGCGTGTTCTCCTTCTACATTAAGGGTTAAGGGCGAGCTGAAGCACTCCTCAAGGTGTTCACCCTGGCAGAGAGTCTCTGGCCGAGCTTCCATCAATAATGTCAATAATGACCCATGCCTCGGTTCAAAACTTTGGGCATCACTGACGGTCGAGCAGGCCCTTGAAATTGCATCGAGAAGGCCTAAGTTACTCGCATCACATCTCCATTCGACTGCTATCAGGTGAAGAAGTCTTAAGACGCTCTCGCTGCAAGAATGCTCTGAAGGTTGCCAAATGAGAAGGTGTTGCATCCCTCTTTGCATCCGCAGCACAAGATCGCTCTGAA

Full Affymetrix probeset data:

Annotations for 1623861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720