FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623862_at:

>probe:Drosophila_2:1623862_at:17:697; Interrogation_Position=331; Antisense; TTTCTCGTCCAAGGCGGCGACATTG
>probe:Drosophila_2:1623862_at:653:725; Interrogation_Position=353; Antisense; TTGTGAACGGCGACGGAACTGGCTC
>probe:Drosophila_2:1623862_at:37:563; Interrogation_Position=367; Antisense; GGAACTGGCTCCATTAGCATCTATG
>probe:Drosophila_2:1623862_at:233:267; Interrogation_Position=425; Antisense; CGGTGGAGCACAACAGACCCGGTTA
>probe:Drosophila_2:1623862_at:142:409; Interrogation_Position=440; Antisense; GACCCGGTTACTTGGGCATGGCCAA
>probe:Drosophila_2:1623862_at:426:573; Interrogation_Position=484; Antisense; GGCTGCCAGTTTTATGTGACCACCG
>probe:Drosophila_2:1623862_at:133:393; Interrogation_Position=530; Antisense; GAAAGCACACCGTTTTCGGCAAGGT
>probe:Drosophila_2:1623862_at:214:557; Interrogation_Position=567; Antisense; GGACACCATCTATGCCATTGAGGAT
>probe:Drosophila_2:1623862_at:431:455; Interrogation_Position=601; Antisense; GATACGGATGACTTCCCCGTGGAAC
>probe:Drosophila_2:1623862_at:272:519; Interrogation_Position=628; Antisense; GTGGTGATCTCCAACTGCGGCGAGA
>probe:Drosophila_2:1623862_at:430:427; Interrogation_Position=649; Antisense; GAGATACCCACGGAGCAGTTCGAGT
>probe:Drosophila_2:1623862_at:328:115; Interrogation_Position=662; Antisense; AGCAGTTCGAGTTCTACCCGGACGA
>probe:Drosophila_2:1623862_at:549:555; Interrogation_Position=681; Antisense; GGACGACTTCAACATCCTCGGATGG
>probe:Drosophila_2:1623862_at:194:189; Interrogation_Position=781; Antisense; AACATGTACTGCTGAGGACTTTGGA

Paste this into a BLAST search page for me
TTTCTCGTCCAAGGCGGCGACATTGTTGTGAACGGCGACGGAACTGGCTCGGAACTGGCTCCATTAGCATCTATGCGGTGGAGCACAACAGACCCGGTTAGACCCGGTTACTTGGGCATGGCCAAGGCTGCCAGTTTTATGTGACCACCGGAAAGCACACCGTTTTCGGCAAGGTGGACACCATCTATGCCATTGAGGATGATACGGATGACTTCCCCGTGGAACGTGGTGATCTCCAACTGCGGCGAGAGAGATACCCACGGAGCAGTTCGAGTAGCAGTTCGAGTTCTACCCGGACGAGGACGACTTCAACATCCTCGGATGGAACATGTACTGCTGAGGACTTTGGA

Full Affymetrix probeset data:

Annotations for 1623862_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720