FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623864_at:

>probe:Drosophila_2:1623864_at:417:703; Interrogation_Position=1047; Antisense; TTATAAGGAGCGCATGCTGGCCACC
>probe:Drosophila_2:1623864_at:484:507; Interrogation_Position=1078; Antisense; GTGCTTCGAGATGAGTTGCCCGACT
>probe:Drosophila_2:1623864_at:657:137; Interrogation_Position=1123; Antisense; ACGGGCGGATACTTCATTTGGGTGC
>probe:Drosophila_2:1623864_at:422:507; Interrogation_Position=1144; Antisense; GTGCGGATACCGGATCGATTGGACT
>probe:Drosophila_2:1623864_at:57:395; Interrogation_Position=1165; Antisense; GACTGCCGGGAGTTTCTCAAGTACT
>probe:Drosophila_2:1623864_at:165:685; Interrogation_Position=1215; Antisense; TATAGTAGGAACACGCTTCTCTGCG
>probe:Drosophila_2:1623864_at:384:221; Interrogation_Position=1248; Antisense; AAGTGGCAAACAGTTCTTCCGCCTG
>probe:Drosophila_2:1623864_at:410:45; Interrogation_Position=1276; Antisense; ATCGCCTTCTATCCGAAGTCGAAGT
>probe:Drosophila_2:1623864_at:31:617; Interrogation_Position=1311; Antisense; TGCTAGAAGACTTTGCAACGCACTT
>probe:Drosophila_2:1623864_at:218:675; Interrogation_Position=1346; Antisense; TAGCCGAGCAATAGATTCCCCATGG
>probe:Drosophila_2:1623864_at:494:9; Interrogation_Position=1360; Antisense; ATTCCCCATGGCGTATCTTAATATG
>probe:Drosophila_2:1623864_at:509:595; Interrogation_Position=1403; Antisense; TGTGGTTATCTGCTATCGTACTTTA
>probe:Drosophila_2:1623864_at:637:511; Interrogation_Position=1446; Antisense; GTGACTGTGCACTAAACTACTTATC
>probe:Drosophila_2:1623864_at:120:491; Interrogation_Position=1520; Antisense; GTACAGATTCTTGGGCATGACGCTA

Paste this into a BLAST search page for me
TTATAAGGAGCGCATGCTGGCCACCGTGCTTCGAGATGAGTTGCCCGACTACGGGCGGATACTTCATTTGGGTGCGTGCGGATACCGGATCGATTGGACTGACTGCCGGGAGTTTCTCAAGTACTTATAGTAGGAACACGCTTCTCTGCGAAGTGGCAAACAGTTCTTCCGCCTGATCGCCTTCTATCCGAAGTCGAAGTTGCTAGAAGACTTTGCAACGCACTTTAGCCGAGCAATAGATTCCCCATGGATTCCCCATGGCGTATCTTAATATGTGTGGTTATCTGCTATCGTACTTTAGTGACTGTGCACTAAACTACTTATCGTACAGATTCTTGGGCATGACGCTA

Full Affymetrix probeset data:

Annotations for 1623864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720