FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623866_at:

>probe:Drosophila_2:1623866_at:2:437; Interrogation_Position=1006; Antisense; GAGGAGATCAAATACCTTCCCGATG
>probe:Drosophila_2:1623866_at:398:241; Interrogation_Position=1016; Antisense; AATACCTTCCCGATGATAGCGACGA
>probe:Drosophila_2:1623866_at:443:27; Interrogation_Position=1031; Antisense; ATAGCGACGATATCAGTGTGTTTCA
>probe:Drosophila_2:1623866_at:18:517; Interrogation_Position=1082; Antisense; GTGTGATCAAGGAATCTCTTCGCTT
>probe:Drosophila_2:1623866_at:169:277; Interrogation_Position=1121; Antisense; CTTTCATTGGACGTCGGTGCGTGGA
>probe:Drosophila_2:1623866_at:263:537; Interrogation_Position=1155; Antisense; GGTCAACGGTTTAATCATGCCCAAG
>probe:Drosophila_2:1623866_at:585:131; Interrogation_Position=1183; Antisense; ACCCAAATCAACATTCACCTTTACG
>probe:Drosophila_2:1623866_at:635:607; Interrogation_Position=1214; Antisense; TGAGGGATGCCCGACACTTTTCAAA
>probe:Drosophila_2:1623866_at:689:57; Interrogation_Position=1246; Antisense; ATGTTTCAACCGGATCGATTCTTTC
>probe:Drosophila_2:1623866_at:686:545; Interrogation_Position=1257; Antisense; GGATCGATTCTTTCCGGAGAACACA
>probe:Drosophila_2:1623866_at:77:343; Interrogation_Position=1300; Antisense; GCTTTTGTGCCATTTAGTGCGGGAC
>probe:Drosophila_2:1623866_at:687:13; Interrogation_Position=1363; Antisense; ATTAAAGTTCTTCTGGCTGCGGTCA
>probe:Drosophila_2:1623866_at:706:287; Interrogation_Position=1375; Antisense; CTGGCTGCGGTCATCAGGAATTTTA
>probe:Drosophila_2:1623866_at:523:21; Interrogation_Position=1402; Antisense; ATATTACCTGTTACTCTTCTCGATG

Paste this into a BLAST search page for me
GAGGAGATCAAATACCTTCCCGATGAATACCTTCCCGATGATAGCGACGAATAGCGACGATATCAGTGTGTTTCAGTGTGATCAAGGAATCTCTTCGCTTCTTTCATTGGACGTCGGTGCGTGGAGGTCAACGGTTTAATCATGCCCAAGACCCAAATCAACATTCACCTTTACGTGAGGGATGCCCGACACTTTTCAAAATGTTTCAACCGGATCGATTCTTTCGGATCGATTCTTTCCGGAGAACACAGCTTTTGTGCCATTTAGTGCGGGACATTAAAGTTCTTCTGGCTGCGGTCACTGGCTGCGGTCATCAGGAATTTTAATATTACCTGTTACTCTTCTCGATG

Full Affymetrix probeset data:

Annotations for 1623866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720