Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623867_at:

>probe:Drosophila_2:1623867_at:318:681; Interrogation_Position=1619; Antisense; TATCTGGAAGTGACAACCCACCGGT
>probe:Drosophila_2:1623867_at:523:49; Interrogation_Position=1671; Antisense; ATGCGATGCCAATGACCGGGAAGTG
>probe:Drosophila_2:1623867_at:287:577; Interrogation_Position=1694; Antisense; TGGCGGAAATATCGCGCTCCACTGA
>probe:Drosophila_2:1623867_at:100:249; Interrogation_Position=1722; Antisense; CAATCGCCTGGCCAAGGACAAGAAA
>probe:Drosophila_2:1623867_at:185:109; Interrogation_Position=1787; Antisense; AGCAGGAACCTCTGTCCGAGGAGCA
>probe:Drosophila_2:1623867_at:53:399; Interrogation_Position=1832; Antisense; GACACGATGTCATTGAGGAGCTCGA
>probe:Drosophila_2:1623867_at:53:119; Interrogation_Position=1850; Antisense; AGCTCGAGGAGCATTTGGTGCGCAA
>probe:Drosophila_2:1623867_at:473:727; Interrogation_Position=1864; Antisense; TTGGTGCGCAAAAACAATCCCCGGC
>probe:Drosophila_2:1623867_at:412:537; Interrogation_Position=1961; Antisense; GGTACCGTCCCAAGGATGCCTACAA
>probe:Drosophila_2:1623867_at:427:443; Interrogation_Position=1987; Antisense; GATGAGTTCATTGCCGAGACCCTGA
>probe:Drosophila_2:1623867_at:237:71; Interrogation_Position=2018; Antisense; AGGCGGAGCTCATCACGGGCAGCAC
>probe:Drosophila_2:1623867_at:332:205; Interrogation_Position=2071; Antisense; AAGCCGGAGCGCAAAATCGATCTGA
>probe:Drosophila_2:1623867_at:533:43; Interrogation_Position=2096; Antisense; ATCGCAGCGAGGTGTACAAGTATCT
>probe:Drosophila_2:1623867_at:403:151; Interrogation_Position=2192; Antisense; ACATTCGCCAGTCACTGCAATCGTA

Paste this into a BLAST search page for me
TATCTGGAAGTGACAACCCACCGGTATGCGATGCCAATGACCGGGAAGTGTGGCGGAAATATCGCGCTCCACTGACAATCGCCTGGCCAAGGACAAGAAAAGCAGGAACCTCTGTCCGAGGAGCAGACACGATGTCATTGAGGAGCTCGAAGCTCGAGGAGCATTTGGTGCGCAATTGGTGCGCAAAAACAATCCCCGGCGGTACCGTCCCAAGGATGCCTACAAGATGAGTTCATTGCCGAGACCCTGAAGGCGGAGCTCATCACGGGCAGCACAAGCCGGAGCGCAAAATCGATCTGAATCGCAGCGAGGTGTACAAGTATCTACATTCGCCAGTCACTGCAATCGTA

Full Affymetrix probeset data:

Annotations for 1623867_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime