FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623871_at:

>probe:Drosophila_2:1623871_at:203:679; Interrogation_Position=453; Antisense; TAGGGCCGGCGAGTTTGTCATGAAC
>probe:Drosophila_2:1623871_at:515:223; Interrogation_Position=536; Antisense; AAGGATTCATTTTTCAGTCGGGTAT
>probe:Drosophila_2:1623871_at:69:657; Interrogation_Position=564; Antisense; TAATGTGGCTCTTATTTTCGTAAAA
>probe:Drosophila_2:1623871_at:296:157; Interrogation_Position=589; Antisense; ACACCGTTCGTGCTAAACGATCGCA
>probe:Drosophila_2:1623871_at:120:431; Interrogation_Position=617; Antisense; GAGTATTGACGTTGCCAAGCCGACA
>probe:Drosophila_2:1623871_at:194:513; Interrogation_Position=688; Antisense; GTGAGTTCCCATGATCAAAGCCGTA
>probe:Drosophila_2:1623871_at:232:197; Interrogation_Position=753; Antisense; AACGACATGCGTGGCTCAGTTTAGA
>probe:Drosophila_2:1623871_at:443:363; Interrogation_Position=795; Antisense; GAATTTTGATCTTCATCCGAGTCTG
>probe:Drosophila_2:1623871_at:36:295; Interrogation_Position=812; Antisense; CGAGTCTGATTTGCGCCCGAAGTGA
>probe:Drosophila_2:1623871_at:436:29; Interrogation_Position=838; Antisense; ATAAACCGGGATTTCTGCTTTGGCG
>probe:Drosophila_2:1623871_at:31:437; Interrogation_Position=866; Antisense; GAGGTTATGCATTGTTCTGCTCCCT
>probe:Drosophila_2:1623871_at:408:603; Interrogation_Position=878; Antisense; TGTTCTGCTCCCTCGGAGATGAGAA
>probe:Drosophila_2:1623871_at:384:609; Interrogation_Position=897; Antisense; TGAGAATCCACACGTCTTCGAGCAG
>probe:Drosophila_2:1623871_at:444:473; Interrogation_Position=950; Antisense; GTGGATTGGACCTCCCGGGAATCTA

Paste this into a BLAST search page for me
TAGGGCCGGCGAGTTTGTCATGAACAAGGATTCATTTTTCAGTCGGGTATTAATGTGGCTCTTATTTTCGTAAAAACACCGTTCGTGCTAAACGATCGCAGAGTATTGACGTTGCCAAGCCGACAGTGAGTTCCCATGATCAAAGCCGTAAACGACATGCGTGGCTCAGTTTAGAGAATTTTGATCTTCATCCGAGTCTGCGAGTCTGATTTGCGCCCGAAGTGAATAAACCGGGATTTCTGCTTTGGCGGAGGTTATGCATTGTTCTGCTCCCTTGTTCTGCTCCCTCGGAGATGAGAATGAGAATCCACACGTCTTCGAGCAGGTGGATTGGACCTCCCGGGAATCTA

Full Affymetrix probeset data:

Annotations for 1623871_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720