Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623873_at:

>probe:Drosophila_2:1623873_at:122:109; Interrogation_Position=1658; Antisense; AGAACGACTGCATCGCTGGAAGCAA
>probe:Drosophila_2:1623873_at:138:113; Interrogation_Position=1678; Antisense; AGCAAATCGAGACGTGCCTTGGCTT
>probe:Drosophila_2:1623873_at:313:139; Interrogation_Position=1689; Antisense; ACGTGCCTTGGCTTAAACATTGTGA
>probe:Drosophila_2:1623873_at:207:613; Interrogation_Position=1711; Antisense; TGAACAACAATGGTCTGCCCTACTT
>probe:Drosophila_2:1623873_at:172:283; Interrogation_Position=1725; Antisense; CTGCCCTACTTGGAGAATGTTCTGT
>probe:Drosophila_2:1623873_at:422:521; Interrogation_Position=1763; Antisense; GGGCTTACAAAGTTCCATGGGCATG
>probe:Drosophila_2:1623873_at:34:203; Interrogation_Position=1793; Antisense; AACCAAGGGTTCTAGAGCACGTATT
>probe:Drosophila_2:1623873_at:417:355; Interrogation_Position=1809; Antisense; GCACGTATTACCAACAGCACCGAAG
>probe:Drosophila_2:1623873_at:534:111; Interrogation_Position=1824; Antisense; AGCACCGAAGACCTGGACGATGAGT
>probe:Drosophila_2:1623873_at:585:691; Interrogation_Position=1869; Antisense; TTTGAGAACTTTTCGCTGCTTGCCA
>probe:Drosophila_2:1623873_at:180:289; Interrogation_Position=1894; Antisense; CGGAATAAGGCTTGTGCGCTCGGTC
>probe:Drosophila_2:1623873_at:498:505; Interrogation_Position=1907; Antisense; GTGCGCTCGGTCTGTGAGGACAATA
>probe:Drosophila_2:1623873_at:381:73; Interrogation_Position=1923; Antisense; AGGACAATAAAACCCAGCTCTTCAG
>probe:Drosophila_2:1623873_at:296:179; Interrogation_Position=1983; Antisense; AAAACCGCTTATTGAACCCTGAATG

Paste this into a BLAST search page for me
AGAACGACTGCATCGCTGGAAGCAAAGCAAATCGAGACGTGCCTTGGCTTACGTGCCTTGGCTTAAACATTGTGATGAACAACAATGGTCTGCCCTACTTCTGCCCTACTTGGAGAATGTTCTGTGGGCTTACAAAGTTCCATGGGCATGAACCAAGGGTTCTAGAGCACGTATTGCACGTATTACCAACAGCACCGAAGAGCACCGAAGACCTGGACGATGAGTTTTGAGAACTTTTCGCTGCTTGCCACGGAATAAGGCTTGTGCGCTCGGTCGTGCGCTCGGTCTGTGAGGACAATAAGGACAATAAAACCCAGCTCTTCAGAAAACCGCTTATTGAACCCTGAATG

Full Affymetrix probeset data:

Annotations for 1623873_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime