FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623874_at:

>probe:Drosophila_2:1623874_at:509:535; Interrogation_Position=6170; Antisense; GGTGCGCAAACCGAAGACTGCTCGT
>probe:Drosophila_2:1623874_at:717:495; Interrogation_Position=6201; Antisense; GTCAGATCGCGCAAGACGAGCTCAG
>probe:Drosophila_2:1623874_at:56:633; Interrogation_Position=6257; Antisense; TCCGATCGATGCTCCCATAGATGTA
>probe:Drosophila_2:1623874_at:273:23; Interrogation_Position=6273; Antisense; ATAGATGTACCCGATTCAACTGCAC
>probe:Drosophila_2:1623874_at:642:675; Interrogation_Position=6332; Antisense; TAGGCGACGCATCTCGGAACTGAGC
>probe:Drosophila_2:1623874_at:568:417; Interrogation_Position=6353; Antisense; GAGCGATCAGTCTGCGAATGGCACA
>probe:Drosophila_2:1623874_at:563:67; Interrogation_Position=6370; Antisense; ATGGCACAGGTGACCTTCGCTCGGA
>probe:Drosophila_2:1623874_at:452:269; Interrogation_Position=6392; Antisense; GGAAGCCTCCAGTTCTAGGACCGGC
>probe:Drosophila_2:1623874_at:244:681; Interrogation_Position=6407; Antisense; TAGGACCGGCTCTAAGTCCAACTCT
>probe:Drosophila_2:1623874_at:151:109; Interrogation_Position=6445; Antisense; AGAACCGGGAGCTACGTCCGCGCTT
>probe:Drosophila_2:1623874_at:182:503; Interrogation_Position=6472; Antisense; GTCGCACCTCCAAGTCGGAGCATTA
>probe:Drosophila_2:1623874_at:159:15; Interrogation_Position=6493; Antisense; ATTAGTTATGCACCCGGATCACCGG
>probe:Drosophila_2:1623874_at:172:455; Interrogation_Position=6509; Antisense; GATCACCGGATCAGCAGACTCAGAA
>probe:Drosophila_2:1623874_at:594:365; Interrogation_Position=6531; Antisense; GAATCGGCTCGGAAGGCACTGTATT

Paste this into a BLAST search page for me
GGTGCGCAAACCGAAGACTGCTCGTGTCAGATCGCGCAAGACGAGCTCAGTCCGATCGATGCTCCCATAGATGTAATAGATGTACCCGATTCAACTGCACTAGGCGACGCATCTCGGAACTGAGCGAGCGATCAGTCTGCGAATGGCACAATGGCACAGGTGACCTTCGCTCGGAGGAAGCCTCCAGTTCTAGGACCGGCTAGGACCGGCTCTAAGTCCAACTCTAGAACCGGGAGCTACGTCCGCGCTTGTCGCACCTCCAAGTCGGAGCATTAATTAGTTATGCACCCGGATCACCGGGATCACCGGATCAGCAGACTCAGAAGAATCGGCTCGGAAGGCACTGTATT

Full Affymetrix probeset data:

Annotations for 1623874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720