FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623875_at:

>probe:Drosophila_2:1623875_at:280:225; Interrogation_Position=1017; Antisense; AAGGAGGATTTTACTCCGCCGCTGA
>probe:Drosophila_2:1623875_at:717:357; Interrogation_Position=1042; Antisense; GCAACTGCAATTGCTTGACTTGCCA
>probe:Drosophila_2:1623875_at:388:611; Interrogation_Position=1057; Antisense; TGACTTGCCAGAAACACACGCGTGC
>probe:Drosophila_2:1623875_at:655:383; Interrogation_Position=1110; Antisense; GAACTATTAGGTCCCATCTTACTGA
>probe:Drosophila_2:1623875_at:332:541; Interrogation_Position=1136; Antisense; GGTTCACAACCTTTATCACTACATG
>probe:Drosophila_2:1623875_at:1:215; Interrogation_Position=1195; Antisense; AAGATACGCTTCCACAGCTGACGGA
>probe:Drosophila_2:1623875_at:629:519; Interrogation_Position=1251; Antisense; GTGGATTATTCCATCGCAGCCAATA
>probe:Drosophila_2:1623875_at:556:677; Interrogation_Position=799; Antisense; TAGAGCACTGCGTCAAGCAGCTGGA
>probe:Drosophila_2:1623875_at:266:205; Interrogation_Position=831; Antisense; AAGCCTAAGATATTGCCGGGTGCAT
>probe:Drosophila_2:1623875_at:584:601; Interrogation_Position=901; Antisense; TGTTTGACACTTCCTACGCATATTG
>probe:Drosophila_2:1623875_at:223:509; Interrogation_Position=925; Antisense; GTGCTTCTCTAAACTTCAAGGCTTT
>probe:Drosophila_2:1623875_at:679:71; Interrogation_Position=943; Antisense; AGGCTTTGTCATTTAGTTTTGTGCA
>probe:Drosophila_2:1623875_at:708:445; Interrogation_Position=969; Antisense; GATGCAGTGGAGCATGTGCCTTTCT
>probe:Drosophila_2:1623875_at:176:507; Interrogation_Position=984; Antisense; GTGCCTTTCTTGGACATAACCGACG

Paste this into a BLAST search page for me
AAGGAGGATTTTACTCCGCCGCTGAGCAACTGCAATTGCTTGACTTGCCATGACTTGCCAGAAACACACGCGTGCGAACTATTAGGTCCCATCTTACTGAGGTTCACAACCTTTATCACTACATGAAGATACGCTTCCACAGCTGACGGAGTGGATTATTCCATCGCAGCCAATATAGAGCACTGCGTCAAGCAGCTGGAAAGCCTAAGATATTGCCGGGTGCATTGTTTGACACTTCCTACGCATATTGGTGCTTCTCTAAACTTCAAGGCTTTAGGCTTTGTCATTTAGTTTTGTGCAGATGCAGTGGAGCATGTGCCTTTCTGTGCCTTTCTTGGACATAACCGACG

Full Affymetrix probeset data:

Annotations for 1623875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720