Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623878_at:

>probe:Drosophila_2:1623878_at:29:653; Interrogation_Position=3815; Antisense; TCAAGTGTGCTACTATATGCGGCAT
>probe:Drosophila_2:1623878_at:680:681; Interrogation_Position=3830; Antisense; TATGCGGCATTTGGCTTTGTCAATT
>probe:Drosophila_2:1623878_at:54:567; Interrogation_Position=3874; Antisense; GGCAGCAGCCGATGGCACTGATGAT
>probe:Drosophila_2:1623878_at:631:481; Interrogation_Position=3981; Antisense; GTATATATTATCCATCTATCCAGAA
>probe:Drosophila_2:1623878_at:517:363; Interrogation_Position=4003; Antisense; GAATTGTATCTCAATGTGCCCGACA
>probe:Drosophila_2:1623878_at:71:677; Interrogation_Position=4037; Antisense; TAGACTTCGATTTCCATGTGCGTGT
>probe:Drosophila_2:1623878_at:710:629; Interrogation_Position=4049; Antisense; TCCATGTGCGTGTCTCAAGGAGGTA
>probe:Drosophila_2:1623878_at:165:679; Interrogation_Position=4108; Antisense; TAGTGCTTAAGAGCCGCAGATTTAC
>probe:Drosophila_2:1623878_at:125:707; Interrogation_Position=4232; Antisense; TTACAAGTGCGATCCTTCTTGGTCG
>probe:Drosophila_2:1623878_at:706:535; Interrogation_Position=4252; Antisense; GGTCGCAGCTAACCAAAGTTGTCCA
>probe:Drosophila_2:1623878_at:690:171; Interrogation_Position=4266; Antisense; AAAGTTGTCCACGTTTTGCTCATCA
>probe:Drosophila_2:1623878_at:518:721; Interrogation_Position=4281; Antisense; TTGCTCATCATCCTAACTGTTGTTC
>probe:Drosophila_2:1623878_at:491:195; Interrogation_Position=4295; Antisense; AACTGTTGTTCTATATCGTTGCTAT
>probe:Drosophila_2:1623878_at:546:469; Interrogation_Position=4312; Antisense; GTTGCTATTACCGATCTACACTATG

Paste this into a BLAST search page for me
TCAAGTGTGCTACTATATGCGGCATTATGCGGCATTTGGCTTTGTCAATTGGCAGCAGCCGATGGCACTGATGATGTATATATTATCCATCTATCCAGAAGAATTGTATCTCAATGTGCCCGACATAGACTTCGATTTCCATGTGCGTGTTCCATGTGCGTGTCTCAAGGAGGTATAGTGCTTAAGAGCCGCAGATTTACTTACAAGTGCGATCCTTCTTGGTCGGGTCGCAGCTAACCAAAGTTGTCCAAAAGTTGTCCACGTTTTGCTCATCATTGCTCATCATCCTAACTGTTGTTCAACTGTTGTTCTATATCGTTGCTATGTTGCTATTACCGATCTACACTATG

Full Affymetrix probeset data:

Annotations for 1623878_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime