FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623879_at:

>probe:Drosophila_2:1623879_at:21:211; Interrogation_Position=391; Antisense; AAGACCGATACGCATCTGAGGACCC
>probe:Drosophila_2:1623879_at:593:523; Interrogation_Position=497; Antisense; GGGAACTTAGTTCGGCCATGGACAT
>probe:Drosophila_2:1623879_at:468:39; Interrogation_Position=527; Antisense; ATCTGCTTCGGATCGAGATCGCCGA
>probe:Drosophila_2:1623879_at:647:633; Interrogation_Position=545; Antisense; TCGCCGAGACGGATGCACTGTTGGA
>probe:Drosophila_2:1623879_at:291:233; Interrogation_Position=573; Antisense; AATGCTATTCGATGCCAAGGCACTC
>probe:Drosophila_2:1623879_at:6:169; Interrogation_Position=641; Antisense; AAATGATCCGCAGCCTGGAGATGGA
>probe:Drosophila_2:1623879_at:60:457; Interrogation_Position=693; Antisense; GATAGAGGCCATTCAGTCGGACTGC
>probe:Drosophila_2:1623879_at:161:269; Interrogation_Position=733; Antisense; CAGGATCTCTGGAGCCGATGTCAAC
>probe:Drosophila_2:1623879_at:683:441; Interrogation_Position=749; Antisense; GATGTCAACGCTCTTTGGAACGCCA
>probe:Drosophila_2:1623879_at:637:81; Interrogation_Position=806; Antisense; AGGGTCTGTATCTGGATCGGAATCC
>probe:Drosophila_2:1623879_at:716:367; Interrogation_Position=825; Antisense; GAATCCAGGCAAGGGCACCGGCAAG
>probe:Drosophila_2:1623879_at:690:175; Interrogation_Position=857; Antisense; AAACCGATATGGCTGACTCTCAGGA
>probe:Drosophila_2:1623879_at:715:425; Interrogation_Position=883; Antisense; GAGATGCTACCTATCTCGTCCAATT
>probe:Drosophila_2:1623879_at:438:639; Interrogation_Position=898; Antisense; TCGTCCAATTCGATTTGCCAATGGT

Paste this into a BLAST search page for me
AAGACCGATACGCATCTGAGGACCCGGGAACTTAGTTCGGCCATGGACATATCTGCTTCGGATCGAGATCGCCGATCGCCGAGACGGATGCACTGTTGGAAATGCTATTCGATGCCAAGGCACTCAAATGATCCGCAGCCTGGAGATGGAGATAGAGGCCATTCAGTCGGACTGCCAGGATCTCTGGAGCCGATGTCAACGATGTCAACGCTCTTTGGAACGCCAAGGGTCTGTATCTGGATCGGAATCCGAATCCAGGCAAGGGCACCGGCAAGAAACCGATATGGCTGACTCTCAGGAGAGATGCTACCTATCTCGTCCAATTTCGTCCAATTCGATTTGCCAATGGT

Full Affymetrix probeset data:

Annotations for 1623879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720