Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623880_at:

>probe:Drosophila_2:1623880_at:135:239; Interrogation_Position=1303; Antisense; AATCAGACAAACGTGGTGGCTTCCA
>probe:Drosophila_2:1623880_at:280:521; Interrogation_Position=1318; Antisense; GTGGCTTCCACATCGAGCAGTGCAG
>probe:Drosophila_2:1623880_at:588:431; Interrogation_Position=1414; Antisense; GAGTCGGGCAATACCAGCGAATCCA
>probe:Drosophila_2:1623880_at:454:545; Interrogation_Position=1474; Antisense; GGATCAGCGGCCAGCAGTCAACAGG
>probe:Drosophila_2:1623880_at:517:417; Interrogation_Position=1531; Antisense; GAGAAGTCGACTGCGGTTCAAGCCA
>probe:Drosophila_2:1623880_at:195:711; Interrogation_Position=1547; Antisense; TTCAAGCCACATCGTCCGGAACAGT
>probe:Drosophila_2:1623880_at:579:189; Interrogation_Position=1642; Antisense; AACTTGTCATCAGCCACTTCGGGTG
>probe:Drosophila_2:1623880_at:634:637; Interrogation_Position=1660; Antisense; TCGGGTGGCTCAGCAACCATTGCGA
>probe:Drosophila_2:1623880_at:362:215; Interrogation_Position=1700; Antisense; AAGATGCCGAATCGGATCTGCCCTT
>probe:Drosophila_2:1623880_at:635:545; Interrogation_Position=1713; Antisense; GGATCTGCCCTTGGCCAAGATCAAG
>probe:Drosophila_2:1623880_at:233:551; Interrogation_Position=1782; Antisense; GGAGACCAACATCAGTTCGGGCAGT
>probe:Drosophila_2:1623880_at:486:263; Interrogation_Position=1821; Antisense; CAGCAAGGCCAATTCCGCGGAGATG
>probe:Drosophila_2:1623880_at:3:447; Interrogation_Position=1842; Antisense; GATGCAGCGCAGTCGGGATGCCTCA
>probe:Drosophila_2:1623880_at:681:545; Interrogation_Position=1857; Antisense; GGATGCCTCACCATCGGGTAAGTGA

Paste this into a BLAST search page for me
AATCAGACAAACGTGGTGGCTTCCAGTGGCTTCCACATCGAGCAGTGCAGGAGTCGGGCAATACCAGCGAATCCAGGATCAGCGGCCAGCAGTCAACAGGGAGAAGTCGACTGCGGTTCAAGCCATTCAAGCCACATCGTCCGGAACAGTAACTTGTCATCAGCCACTTCGGGTGTCGGGTGGCTCAGCAACCATTGCGAAAGATGCCGAATCGGATCTGCCCTTGGATCTGCCCTTGGCCAAGATCAAGGGAGACCAACATCAGTTCGGGCAGTCAGCAAGGCCAATTCCGCGGAGATGGATGCAGCGCAGTCGGGATGCCTCAGGATGCCTCACCATCGGGTAAGTGA

Full Affymetrix probeset data:

Annotations for 1623880_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime