Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623881_s_at:

>probe:Drosophila_2:1623881_s_at:569:507; Interrogation_Position=1013; Antisense; GTGCGGCGATGTCATACCCAAACTG
>probe:Drosophila_2:1623881_s_at:47:673; Interrogation_Position=1027; Antisense; TACCCAAACTGTTCGACTTTCGCAA
>probe:Drosophila_2:1623881_s_at:28:175; Interrogation_Position=1118; Antisense; AAAGCCAGGCTTTCTATTTTAGCTA
>probe:Drosophila_2:1623881_s_at:33:221; Interrogation_Position=606; Antisense; AAGTGCCTGTCATGCGAGTACCGGA
>probe:Drosophila_2:1623881_s_at:211:431; Interrogation_Position=621; Antisense; GAGTACCGGATCGATCGTCACGAGT
>probe:Drosophila_2:1623881_s_at:501:451; Interrogation_Position=633; Antisense; GATCGTCACGAGTTCCAGAGCATAC
>probe:Drosophila_2:1623881_s_at:603:113; Interrogation_Position=651; Antisense; AGCATACTGGCGTCGCTAAATCCGG
>probe:Drosophila_2:1623881_s_at:61:59; Interrogation_Position=696; Antisense; ATGATCCGGCCCGATGGCGATGTAG
>probe:Drosophila_2:1623881_s_at:28:429; Interrogation_Position=720; Antisense; GAGATACCGCTGGAGTACATCGAGA
>probe:Drosophila_2:1623881_s_at:122:423; Interrogation_Position=741; Antisense; GAGAACTTCCGGATACCCGAGTGTA
>probe:Drosophila_2:1623881_s_at:720:23; Interrogation_Position=786; Antisense; AAGCCGGAAATTGTCTTCTTCGGAG
>probe:Drosophila_2:1623881_s_at:386:259; Interrogation_Position=826; Antisense; CACGAGTGGATCAGATTGCCGGCAT
>probe:Drosophila_2:1623881_s_at:374:665; Interrogation_Position=855; Antisense; TACAATAGCGATGGCCTGCTTGTCC
>probe:Drosophila_2:1623881_s_at:606:223; Interrogation_Position=930; Antisense; AAGGACCTCAAGCTACCGGTGGGCA

Paste this into a BLAST search page for me
GTGCGGCGATGTCATACCCAAACTGTACCCAAACTGTTCGACTTTCGCAAAAAGCCAGGCTTTCTATTTTAGCTAAAGTGCCTGTCATGCGAGTACCGGAGAGTACCGGATCGATCGTCACGAGTGATCGTCACGAGTTCCAGAGCATACAGCATACTGGCGTCGCTAAATCCGGATGATCCGGCCCGATGGCGATGTAGGAGATACCGCTGGAGTACATCGAGAGAGAACTTCCGGATACCCGAGTGTAAAGCCGGAAATTGTCTTCTTCGGAGCACGAGTGGATCAGATTGCCGGCATTACAATAGCGATGGCCTGCTTGTCCAAGGACCTCAAGCTACCGGTGGGCA

Full Affymetrix probeset data:

Annotations for 1623881_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime