FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623882_at:

>probe:Drosophila_2:1623882_at:558:639; Interrogation_Position=1327; Antisense; TCGGCGGACATCTTTAGCTACGTGA
>probe:Drosophila_2:1623882_at:478:671; Interrogation_Position=1345; Antisense; TACGTGATGTGCCTGACGGTGCTAC
>probe:Drosophila_2:1623882_at:355:621; Interrogation_Position=1430; Antisense; TGCTGGCCTTCCCATGGATGTGCTT
>probe:Drosophila_2:1623882_at:625:63; Interrogation_Position=1443; Antisense; ATGGATGTGCTTCTCCCTGATGACT
>probe:Drosophila_2:1623882_at:89:639; Interrogation_Position=1475; Antisense; TCGGCACGAGCCTCTATAAGCGGAA
>probe:Drosophila_2:1623882_at:728:31; Interrogation_Position=1490; Antisense; ATAAGCGGAAGCTCCAGTGGCACAC
>probe:Drosophila_2:1623882_at:18:85; Interrogation_Position=1505; Antisense; AGTGGCACACGCTGGGCAGCATCTG
>probe:Drosophila_2:1623882_at:425:115; Interrogation_Position=1522; Antisense; AGCATCTGCAAGTGCCTGGCGCTGA
>probe:Drosophila_2:1623882_at:511:207; Interrogation_Position=1570; Antisense; AAGCTGCTGCTCAGTGTGTCCGCCG
>probe:Drosophila_2:1623882_at:222:609; Interrogation_Position=1619; Antisense; TGACCGCCTTTCTGCAGGAGCTGGT
>probe:Drosophila_2:1623882_at:525:333; Interrogation_Position=1638; Antisense; GCTGGTCTTCCAGATGGGCATGACG
>probe:Drosophila_2:1623882_at:540:591; Interrogation_Position=1748; Antisense; TGGTGGAGCGGTACTCCTTCCAGGC
>probe:Drosophila_2:1623882_at:331:385; Interrogation_Position=1802; Antisense; GAACTACCACGCTGCTCTGGAACTT
>probe:Drosophila_2:1623882_at:341:645; Interrogation_Position=1829; Antisense; TCTTCTTCTGCTGCCAGAGCAAGGA

Paste this into a BLAST search page for me
TCGGCGGACATCTTTAGCTACGTGATACGTGATGTGCCTGACGGTGCTACTGCTGGCCTTCCCATGGATGTGCTTATGGATGTGCTTCTCCCTGATGACTTCGGCACGAGCCTCTATAAGCGGAAATAAGCGGAAGCTCCAGTGGCACACAGTGGCACACGCTGGGCAGCATCTGAGCATCTGCAAGTGCCTGGCGCTGAAAGCTGCTGCTCAGTGTGTCCGCCGTGACCGCCTTTCTGCAGGAGCTGGTGCTGGTCTTCCAGATGGGCATGACGTGGTGGAGCGGTACTCCTTCCAGGCGAACTACCACGCTGCTCTGGAACTTTCTTCTTCTGCTGCCAGAGCAAGGA

Full Affymetrix probeset data:

Annotations for 1623882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720