FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623883_at:

>probe:Drosophila_2:1623883_at:150:367; Interrogation_Position=260; Antisense; GAATCAGTTCGGTTCGATTGCTGCC
>probe:Drosophila_2:1623883_at:445:541; Interrogation_Position=293; Antisense; GGATTGTCCCACTCGAAATATTCGC
>probe:Drosophila_2:1623883_at:170:127; Interrogation_Position=377; Antisense; AGCCAGCTACGACTACATGTTCAAC
>probe:Drosophila_2:1623883_at:56:59; Interrogation_Position=408; Antisense; ATGATGCACATCAGTCCGTGGTCCT
>probe:Drosophila_2:1623883_at:461:75; Interrogation_Position=483; Antisense; AGGATGTTCACCTACGGACCATATG
>probe:Drosophila_2:1623883_at:635:211; Interrogation_Position=511; Antisense; AAGACGGTATACTCGTTCCACAGAG
>probe:Drosophila_2:1623883_at:2:231; Interrogation_Position=537; Antisense; AATGTGGACTTCGATCGGAGCCTGC
>probe:Drosophila_2:1623883_at:119:569; Interrogation_Position=582; Antisense; GGCGTTCGCGACATTAAGGACCTGA
>probe:Drosophila_2:1623883_at:318:413; Interrogation_Position=600; Antisense; GACCTGAAGGTCTTGGCGGCCGAAA
>probe:Drosophila_2:1623883_at:98:389; Interrogation_Position=639; Antisense; GAAAAGCTCGTCAAGATGCCATCAA
>probe:Drosophila_2:1623883_at:57:185; Interrogation_Position=666; Antisense; AACAAGTTCCTGACCTGGCTAAAGC
>probe:Drosophila_2:1623883_at:401:707; Interrogation_Position=730; Antisense; TTACCCGCTCCTAGATAACATCGTT
>probe:Drosophila_2:1623883_at:511:691; Interrogation_Position=776; Antisense; TATTGTCGTCGAAGTGCCTGCTCAT
>probe:Drosophila_2:1623883_at:156:621; Interrogation_Position=794; Antisense; TGCTCATCGAACTAGGCCAAGTGGT

Paste this into a BLAST search page for me
GAATCAGTTCGGTTCGATTGCTGCCGGATTGTCCCACTCGAAATATTCGCAGCCAGCTACGACTACATGTTCAACATGATGCACATCAGTCCGTGGTCCTAGGATGTTCACCTACGGACCATATGAAGACGGTATACTCGTTCCACAGAGAATGTGGACTTCGATCGGAGCCTGCGGCGTTCGCGACATTAAGGACCTGAGACCTGAAGGTCTTGGCGGCCGAAAGAAAAGCTCGTCAAGATGCCATCAAAACAAGTTCCTGACCTGGCTAAAGCTTACCCGCTCCTAGATAACATCGTTTATTGTCGTCGAAGTGCCTGCTCATTGCTCATCGAACTAGGCCAAGTGGT

Full Affymetrix probeset data:

Annotations for 1623883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720