FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623884_at:

>probe:Drosophila_2:1623884_at:288:505; Interrogation_Position=100; Antisense; GTCCTCGTCCAGATGGTGGCTCAAA
>probe:Drosophila_2:1623884_at:565:47; Interrogation_Position=124; Antisense; ATCCACGGAGGAGTCTACAGCTATG
>probe:Drosophila_2:1623884_at:287:533; Interrogation_Position=159; Antisense; GGTGTACCTGGACAAGACCCTGGAC
>probe:Drosophila_2:1623884_at:603:205; Interrogation_Position=194; Antisense; AAGCGATTCTCGGTGGCGTCGATCC
>probe:Drosophila_2:1623884_at:346:407; Interrogation_Position=220; Antisense; GATGGTTACTACACCTACGTGGGTC
>probe:Drosophila_2:1623884_at:316:517; Interrogation_Position=238; Antisense; GTGGGTCGTGTCACATACAGCAGTA
>probe:Drosophila_2:1623884_at:669:661; Interrogation_Position=261; Antisense; TAACATTCTGCCAGCCCGAGTGGTA
>probe:Drosophila_2:1623884_at:668:671; Interrogation_Position=343; Antisense; TACGAGGTTCTGGTGTCCAACGCCA
>probe:Drosophila_2:1623884_at:698:597; Interrogation_Position=463; Antisense; TGTCGTGTCCGCTGTGATGAATCCA
>probe:Drosophila_2:1623884_at:42:39; Interrogation_Position=487; Antisense; ATCTTTATCGGCACTCTGTACCTTT
>probe:Drosophila_2:1623884_at:14:489; Interrogation_Position=504; Antisense; GTACCTTTCCAAGCGGATGTGCATC
>probe:Drosophila_2:1623884_at:301:237; Interrogation_Position=55; Antisense; AATCGAATCATGTTCTCAGCCAAGA
>probe:Drosophila_2:1623884_at:40:219; Interrogation_Position=565; Antisense; AAGTACGAGATCCTTGTCCGCGAAC
>probe:Drosophila_2:1623884_at:632:91; Interrogation_Position=79; Antisense; AGTTCTGCAATTGTGGCCGTAGTCC

Paste this into a BLAST search page for me
GTCCTCGTCCAGATGGTGGCTCAAAATCCACGGAGGAGTCTACAGCTATGGGTGTACCTGGACAAGACCCTGGACAAGCGATTCTCGGTGGCGTCGATCCGATGGTTACTACACCTACGTGGGTCGTGGGTCGTGTCACATACAGCAGTATAACATTCTGCCAGCCCGAGTGGTATACGAGGTTCTGGTGTCCAACGCCATGTCGTGTCCGCTGTGATGAATCCAATCTTTATCGGCACTCTGTACCTTTGTACCTTTCCAAGCGGATGTGCATCAATCGAATCATGTTCTCAGCCAAGAAAGTACGAGATCCTTGTCCGCGAACAGTTCTGCAATTGTGGCCGTAGTCC

Full Affymetrix probeset data:

Annotations for 1623884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720