Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623885_at:

>probe:Drosophila_2:1623885_at:275:271; Interrogation_Position=1553; Antisense; CATTTCAATCACTTCCGGCAGGTGA
>probe:Drosophila_2:1623885_at:217:621; Interrogation_Position=1580; Antisense; TGCGGAAAACACGTTCGCGGAGTTA
>probe:Drosophila_2:1623885_at:516:549; Interrogation_Position=1598; Antisense; GGAGTTAGTCATGCCGACGATCTCT
>probe:Drosophila_2:1623885_at:452:643; Interrogation_Position=1620; Antisense; TCTCCTACCTTTTCTATCACATTTT
>probe:Drosophila_2:1623885_at:373:455; Interrogation_Position=1658; Antisense; GATAAGTCCTCGATGGAGTACCAAA
>probe:Drosophila_2:1623885_at:387:63; Interrogation_Position=1703; Antisense; ATGTGGGTGGCATTCGCCCGAAACG
>probe:Drosophila_2:1623885_at:711:161; Interrogation_Position=1728; Antisense; ACAATCCCAATTGTCCACAGATCGG
>probe:Drosophila_2:1623885_at:531:393; Interrogation_Position=1780; Antisense; GAAAGGTCCGCAGATGTGTCTCAAT
>probe:Drosophila_2:1623885_at:435:159; Interrogation_Position=1813; Antisense; ACAACTGGAGTTCATTGTGCTGCCG
>probe:Drosophila_2:1623885_at:312:597; Interrogation_Position=1828; Antisense; TGTGCTGCCGGAGTCGAAACAGAAT
>probe:Drosophila_2:1623885_at:103:27; Interrogation_Position=1932; Antisense; ATAGCAGCTGGGTATCGCCAATGAA
>probe:Drosophila_2:1623885_at:228:481; Interrogation_Position=2008; Antisense; GTTTGCTGTCAACATAGCCCTACAA
>probe:Drosophila_2:1623885_at:420:241; Interrogation_Position=2032; Antisense; AATATCGCTTAACGTGCTGTAATCG
>probe:Drosophila_2:1623885_at:416:149; Interrogation_Position=2074; Antisense; ACATTTCAACGTTGGCCATAGGCTA

Paste this into a BLAST search page for me
CATTTCAATCACTTCCGGCAGGTGATGCGGAAAACACGTTCGCGGAGTTAGGAGTTAGTCATGCCGACGATCTCTTCTCCTACCTTTTCTATCACATTTTGATAAGTCCTCGATGGAGTACCAAAATGTGGGTGGCATTCGCCCGAAACGACAATCCCAATTGTCCACAGATCGGGAAAGGTCCGCAGATGTGTCTCAATACAACTGGAGTTCATTGTGCTGCCGTGTGCTGCCGGAGTCGAAACAGAATATAGCAGCTGGGTATCGCCAATGAAGTTTGCTGTCAACATAGCCCTACAAAATATCGCTTAACGTGCTGTAATCGACATTTCAACGTTGGCCATAGGCTA

Full Affymetrix probeset data:

Annotations for 1623885_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime