FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623887_at:

>probe:Drosophila_2:1623887_at:404:449; Interrogation_Position=1004; Antisense; GATCGCCTAGAACACGTGGGTGCCA
>probe:Drosophila_2:1623887_at:585:379; Interrogation_Position=1034; Antisense; GAACGTATCGAGGAACTTCTACTGG
>probe:Drosophila_2:1623887_at:729:697; Interrogation_Position=1089; Antisense; TTTTAATAGTTAGTTCCGATCAGGA
>probe:Drosophila_2:1623887_at:205:371; Interrogation_Position=1118; Antisense; GAATGGTCTGATCCTTACAAGTTTT
>probe:Drosophila_2:1623887_at:648:707; Interrogation_Position=1132; Antisense; TTACAAGTTTTCTGATCGTTCCTCC
>probe:Drosophila_2:1623887_at:602:449; Interrogation_Position=1145; Antisense; GATCGTTCCTCCCAGGATGATGCTT
>probe:Drosophila_2:1623887_at:592:267; Interrogation_Position=1157; Antisense; CAGGATGATGCTTTGGTCGACCAGG
>probe:Drosophila_2:1623887_at:321:73; Interrogation_Position=1191; Antisense; AGGAACGCTGGGATCAAGGCCCCGA
>probe:Drosophila_2:1623887_at:17:227; Interrogation_Position=1206; Antisense; AAGGCCCCGAATCATAAGATACGAT
>probe:Drosophila_2:1623887_at:570:185; Interrogation_Position=1264; Antisense; AACACACTATATTTTGACCAAGGAA
>probe:Drosophila_2:1623887_at:38:463; Interrogation_Position=1291; Antisense; GATTCCTATGTACTCTGTGTGCATT
>probe:Drosophila_2:1623887_at:500:363; Interrogation_Position=1348; Antisense; GAATTCCAGACAAACCGAAGATCGA
>probe:Drosophila_2:1623887_at:250:257; Interrogation_Position=973; Antisense; CACTTGTAATATGCCTATTGCTTTC
>probe:Drosophila_2:1623887_at:193:7; Interrogation_Position=989; Antisense; ATTGCTTTCTTATTGGATCGCCTAG

Paste this into a BLAST search page for me
GATCGCCTAGAACACGTGGGTGCCAGAACGTATCGAGGAACTTCTACTGGTTTTAATAGTTAGTTCCGATCAGGAGAATGGTCTGATCCTTACAAGTTTTTTACAAGTTTTCTGATCGTTCCTCCGATCGTTCCTCCCAGGATGATGCTTCAGGATGATGCTTTGGTCGACCAGGAGGAACGCTGGGATCAAGGCCCCGAAAGGCCCCGAATCATAAGATACGATAACACACTATATTTTGACCAAGGAAGATTCCTATGTACTCTGTGTGCATTGAATTCCAGACAAACCGAAGATCGACACTTGTAATATGCCTATTGCTTTCATTGCTTTCTTATTGGATCGCCTAG

Full Affymetrix probeset data:

Annotations for 1623887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720