FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623888_at:

>probe:Drosophila_2:1623888_at:477:561; Interrogation_Position=2343; Antisense; GGAAGTCCCTCCTGTGAGTAGTGAA
>probe:Drosophila_2:1623888_at:513:459; Interrogation_Position=2472; Antisense; GATTCTCAAGTCATCGGGTAAGGAA
>probe:Drosophila_2:1623888_at:337:175; Interrogation_Position=2496; Antisense; AAAGCCACAGGCCAGTGCCGATAAA
>probe:Drosophila_2:1623888_at:134:221; Interrogation_Position=2568; Antisense; AAGTGCAGCTCCCAAAAACCCAGTG
>probe:Drosophila_2:1623888_at:75:295; Interrogation_Position=2601; Antisense; CGATGCTGATGAAGTGCCCGTCGGT
>probe:Drosophila_2:1623888_at:443:519; Interrogation_Position=2632; Antisense; GTGGATGTACTCAACAGTCTGACTG
>probe:Drosophila_2:1623888_at:152:89; Interrogation_Position=2647; Antisense; AGTCTGACTGGACAGCCGCACGAAG
>probe:Drosophila_2:1623888_at:250:99; Interrogation_Position=2673; Antisense; AGATGAGCTGCTGTTCGCGATTCCA
>probe:Drosophila_2:1623888_at:185:719; Interrogation_Position=2702; Antisense; TTGCTCCCTATCAGGCTTTGCAAAA
>probe:Drosophila_2:1623888_at:554:661; Interrogation_Position=2736; Antisense; TAAAGTAAAGCTCACCCCAGGTACG
>probe:Drosophila_2:1623888_at:625:391; Interrogation_Position=2771; Antisense; GAAAGGCGGCGAAACTAGCACTTAA
>probe:Drosophila_2:1623888_at:609:335; Interrogation_Position=2816; Antisense; GCTGCAGTGCTCGTGAGAAGGACTT
>probe:Drosophila_2:1623888_at:654:71; Interrogation_Position=2883; Antisense; AGGAAAGGTCAAGCTATCGGCCCCG
>probe:Drosophila_2:1623888_at:537:39; Interrogation_Position=2898; Antisense; ATCGGCCCCGCAACTTCAGAAGTAT

Paste this into a BLAST search page for me
GGAAGTCCCTCCTGTGAGTAGTGAAGATTCTCAAGTCATCGGGTAAGGAAAAAGCCACAGGCCAGTGCCGATAAAAAGTGCAGCTCCCAAAAACCCAGTGCGATGCTGATGAAGTGCCCGTCGGTGTGGATGTACTCAACAGTCTGACTGAGTCTGACTGGACAGCCGCACGAAGAGATGAGCTGCTGTTCGCGATTCCATTGCTCCCTATCAGGCTTTGCAAAATAAAGTAAAGCTCACCCCAGGTACGGAAAGGCGGCGAAACTAGCACTTAAGCTGCAGTGCTCGTGAGAAGGACTTAGGAAAGGTCAAGCTATCGGCCCCGATCGGCCCCGCAACTTCAGAAGTAT

Full Affymetrix probeset data:

Annotations for 1623888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720