Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623889_at:

>probe:Drosophila_2:1623889_at:517:433; Interrogation_Position=3360; Antisense; GAGGCTATTAGGTTCTCACGTTTAA
>probe:Drosophila_2:1623889_at:217:441; Interrogation_Position=3432; Antisense; GATGGCAATCTTTTGTTTCTATCTT
>probe:Drosophila_2:1623889_at:614:155; Interrogation_Position=3520; Antisense; ACACCAGAATGTTGAAGCCGTTGAA
>probe:Drosophila_2:1623889_at:249:319; Interrogation_Position=3536; Antisense; GCCGTTGAAGTATTCGTCGTGCTTT
>probe:Drosophila_2:1623889_at:586:637; Interrogation_Position=3549; Antisense; TCGTCGTGCTTTTTCGTCGTGGAGA
>probe:Drosophila_2:1623889_at:402:499; Interrogation_Position=3564; Antisense; GTCGTGGAGATGCTTCTGCTGCTAA
>probe:Drosophila_2:1623889_at:275:335; Interrogation_Position=3581; Antisense; GCTGCTAATATATATCCCCTGTTTA
>probe:Drosophila_2:1623889_at:625:677; Interrogation_Position=3604; Antisense; TAGTATCTATTGCTCTGCGTTACGC
>probe:Drosophila_2:1623889_at:626:543; Interrogation_Position=3643; Antisense; GGATTTCGTTATAGCTTAGTACCTT
>probe:Drosophila_2:1623889_at:229:703; Interrogation_Position=3720; Antisense; TTGTTGTTAAATCCTTACGCTGCAC
>probe:Drosophila_2:1623889_at:709:671; Interrogation_Position=3735; Antisense; TACGCTGCACAGTTTATAGATCCTA
>probe:Drosophila_2:1623889_at:283:485; Interrogation_Position=3764; Antisense; GTATGATATTTTGACTTCCGCCACA
>probe:Drosophila_2:1623889_at:330:311; Interrogation_Position=3783; Antisense; GCCACATCCTTACAAGCACTTACAG
>probe:Drosophila_2:1623889_at:578:439; Interrogation_Position=3816; Antisense; GATGGGCAGCGATTAAACCTTGTAT

Paste this into a BLAST search page for me
GAGGCTATTAGGTTCTCACGTTTAAGATGGCAATCTTTTGTTTCTATCTTACACCAGAATGTTGAAGCCGTTGAAGCCGTTGAAGTATTCGTCGTGCTTTTCGTCGTGCTTTTTCGTCGTGGAGAGTCGTGGAGATGCTTCTGCTGCTAAGCTGCTAATATATATCCCCTGTTTATAGTATCTATTGCTCTGCGTTACGCGGATTTCGTTATAGCTTAGTACCTTTTGTTGTTAAATCCTTACGCTGCACTACGCTGCACAGTTTATAGATCCTAGTATGATATTTTGACTTCCGCCACAGCCACATCCTTACAAGCACTTACAGGATGGGCAGCGATTAAACCTTGTAT

Full Affymetrix probeset data:

Annotations for 1623889_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime