Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623891_at:

>probe:Drosophila_2:1623891_at:443:131; Interrogation_Position=1075; Antisense; ACCGCTCGGCTTTCGGAGAAACTCG
>probe:Drosophila_2:1623891_at:276:337; Interrogation_Position=1107; Antisense; GCTAATCCCATCAAAACTCAGTTCG
>probe:Drosophila_2:1623891_at:327:193; Interrogation_Position=1121; Antisense; AACTCAGTTCGATTCACCAGATAAA
>probe:Drosophila_2:1623891_at:349:227; Interrogation_Position=1144; Antisense; AAGGCTGTCCTCGTGAAGGATTCCA
>probe:Drosophila_2:1623891_at:712:543; Interrogation_Position=652; Antisense; GGATACACTGGCCAGATCGTGGAAA
>probe:Drosophila_2:1623891_at:301:95; Interrogation_Position=665; Antisense; AGATCGTGGAAACCCTTCAGGCGTG
>probe:Drosophila_2:1623891_at:446:71; Interrogation_Position=683; Antisense; AGGCGTGGGTCAACTCCTGCGACAG
>probe:Drosophila_2:1623891_at:419:325; Interrogation_Position=701; Antisense; GCGACAGCGTTTCCAATTGCATCGA
>probe:Drosophila_2:1623891_at:206:463; Interrogation_Position=732; Antisense; GATTAAGTACGCGAATGCCGAGAAA
>probe:Drosophila_2:1623891_at:274:123; Interrogation_Position=779; Antisense; AGCGCGTGGAACAAGATCTCATCAA
>probe:Drosophila_2:1623891_at:196:173; Interrogation_Position=819; Antisense; AAAGAGCCAGACCTCGGATAGCGAT
>probe:Drosophila_2:1623891_at:643:425; Interrogation_Position=844; Antisense; GAGAGCATGCAAATCGACACCCACG
>probe:Drosophila_2:1623891_at:506:289; Interrogation_Position=944; Antisense; CGGCAGTGGGCCTCAAGTTTAGCAA
>probe:Drosophila_2:1623891_at:111:139; Interrogation_Position=992; Antisense; ACGAGGAGTCCGAAGCTGGTTCCAA

Paste this into a BLAST search page for me
ACCGCTCGGCTTTCGGAGAAACTCGGCTAATCCCATCAAAACTCAGTTCGAACTCAGTTCGATTCACCAGATAAAAAGGCTGTCCTCGTGAAGGATTCCAGGATACACTGGCCAGATCGTGGAAAAGATCGTGGAAACCCTTCAGGCGTGAGGCGTGGGTCAACTCCTGCGACAGGCGACAGCGTTTCCAATTGCATCGAGATTAAGTACGCGAATGCCGAGAAAAGCGCGTGGAACAAGATCTCATCAAAAAGAGCCAGACCTCGGATAGCGATGAGAGCATGCAAATCGACACCCACGCGGCAGTGGGCCTCAAGTTTAGCAAACGAGGAGTCCGAAGCTGGTTCCAA

Full Affymetrix probeset data:

Annotations for 1623891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime