FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623892_at:

>probe:Drosophila_2:1623892_at:683:155; Interrogation_Position=1037; Antisense; ACAGCAGCTGGATCCGCTCAAGGTG
>probe:Drosophila_2:1623892_at:364:223; Interrogation_Position=1056; Antisense; AAGGTGGCCGATCTGGTCTATCTGA
>probe:Drosophila_2:1623892_at:100:125; Interrogation_Position=1089; Antisense; AGCCTGGACATGACTCCGCGGGAAG
>probe:Drosophila_2:1623892_at:717:179; Interrogation_Position=1148; Antisense; AAACAAGATGCTACGCTCGCGAATG
>probe:Drosophila_2:1623892_at:260:611; Interrogation_Position=1246; Antisense; TGAATTCCCGAAAGTAGGTCCATTT
>probe:Drosophila_2:1623892_at:284:667; Interrogation_Position=1297; Antisense; TACAGTATACTAAGTCCCGGCACAG
>probe:Drosophila_2:1623892_at:310:567; Interrogation_Position=1315; Antisense; GGCACAGCCGATAACACCAATTGAA
>probe:Drosophila_2:1623892_at:39:573; Interrogation_Position=805; Antisense; GGCGGTGTCCTGGTTTCGAATTCGA
>probe:Drosophila_2:1623892_at:331:591; Interrogation_Position=850; Antisense; TGGTGACGATCGGTCCCAATGGCAC
>probe:Drosophila_2:1623892_at:111:373; Interrogation_Position=876; Antisense; GAAGTTTCCCGCATTAGCCTAAGTG
>probe:Drosophila_2:1623892_at:242:87; Interrogation_Position=897; Antisense; AGTGCCATCAACTGGGACATGACCG
>probe:Drosophila_2:1623892_at:693:137; Interrogation_Position=933; Antisense; ACGAGGAAGCTGCTCTGCGAGATCT
>probe:Drosophila_2:1623892_at:52:623; Interrogation_Position=948; Antisense; TGCGAGATCTTCGACCGGGATACAC
>probe:Drosophila_2:1623892_at:548:199; Interrogation_Position=997; Antisense; AACCATCGCCGGCATTTAGGGACTG

Paste this into a BLAST search page for me
ACAGCAGCTGGATCCGCTCAAGGTGAAGGTGGCCGATCTGGTCTATCTGAAGCCTGGACATGACTCCGCGGGAAGAAACAAGATGCTACGCTCGCGAATGTGAATTCCCGAAAGTAGGTCCATTTTACAGTATACTAAGTCCCGGCACAGGGCACAGCCGATAACACCAATTGAAGGCGGTGTCCTGGTTTCGAATTCGATGGTGACGATCGGTCCCAATGGCACGAAGTTTCCCGCATTAGCCTAAGTGAGTGCCATCAACTGGGACATGACCGACGAGGAAGCTGCTCTGCGAGATCTTGCGAGATCTTCGACCGGGATACACAACCATCGCCGGCATTTAGGGACTG

Full Affymetrix probeset data:

Annotations for 1623892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720