FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623893_at:

>probe:Drosophila_2:1623893_at:126:423; Interrogation_Position=1119; Antisense; GAGAATACTCTTCTGATACTGGAAT
>probe:Drosophila_2:1623893_at:235:147; Interrogation_Position=1125; Antisense; ACTCTTCTGATACTGGAATACTAGA
>probe:Drosophila_2:1623893_at:369:179; Interrogation_Position=1174; Antisense; AAAACATTACTAGCATCCGTACGAA
>probe:Drosophila_2:1623893_at:535:333; Interrogation_Position=1186; Antisense; GCATCCGTACGAAACTAATTAAATT
>probe:Drosophila_2:1623893_at:651:13; Interrogation_Position=1212; Antisense; ATTACCTAATGCTCCATAATGTTAA
>probe:Drosophila_2:1623893_at:49:509; Interrogation_Position=1252; Antisense; GTGAAAGCTCAAAATTTTGCAAGTA
>probe:Drosophila_2:1623893_at:510:693; Interrogation_Position=1267; Antisense; TTTGCAAGTAATTATGACGATTTCA
>probe:Drosophila_2:1623893_at:391:409; Interrogation_Position=1282; Antisense; GACGATTTCATATCCAAATATGCCA
>probe:Drosophila_2:1623893_at:153:23; Interrogation_Position=1299; Antisense; ATATGCCATTTTTGAGCAATAAATC
>probe:Drosophila_2:1623893_at:333:185; Interrogation_Position=756; Antisense; AACAACGACTACTTCCAATCGCCGG
>probe:Drosophila_2:1623893_at:191:245; Interrogation_Position=771; Antisense; CAATCGCCGGCTTTTAAACTAGTCA
>probe:Drosophila_2:1623893_at:655:29; Interrogation_Position=814; Antisense; ATAAACTACACATATCCGCTAAACG
>probe:Drosophila_2:1623893_at:55:267; Interrogation_Position=824; Antisense; CATATCCGCTAAACGACAAAACCTA
>probe:Drosophila_2:1623893_at:477:31; Interrogation_Position=896; Antisense; ATAACCAAATTTCCAGTAAACAGAG

Paste this into a BLAST search page for me
GAGAATACTCTTCTGATACTGGAATACTCTTCTGATACTGGAATACTAGAAAAACATTACTAGCATCCGTACGAAGCATCCGTACGAAACTAATTAAATTATTACCTAATGCTCCATAATGTTAAGTGAAAGCTCAAAATTTTGCAAGTATTTGCAAGTAATTATGACGATTTCAGACGATTTCATATCCAAATATGCCAATATGCCATTTTTGAGCAATAAATCAACAACGACTACTTCCAATCGCCGGCAATCGCCGGCTTTTAAACTAGTCAATAAACTACACATATCCGCTAAACGCATATCCGCTAAACGACAAAACCTAATAACCAAATTTCCAGTAAACAGAG

Full Affymetrix probeset data:

Annotations for 1623893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720