Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623894_a_at:

>probe:Drosophila_2:1623894_a_at:459:203; Interrogation_Position=1017; Antisense; AAGCCTCCGCTGATTCCGGTGATGA
>probe:Drosophila_2:1623894_a_at:35:147; Interrogation_Position=1060; Antisense; ACTACGACGGCGAGTACACGGTGGT
>probe:Drosophila_2:1623894_a_at:470:89; Interrogation_Position=1100; Antisense; AGTCTTCTCCATGCGCGGCAAGTAC
>probe:Drosophila_2:1623894_a_at:201:487; Interrogation_Position=1178; Antisense; GTACTGGGAGAAACGTTCGCCTCCT
>probe:Drosophila_2:1623894_a_at:289:105; Interrogation_Position=1240; Antisense; AGAAACCATTGCCAGTCAACGTTCC
>probe:Drosophila_2:1623894_a_at:383:467; Interrogation_Position=1270; Antisense; GTTGTGTTCGCTCTTTGTTGGAGAA
>probe:Drosophila_2:1623894_a_at:31:223; Interrogation_Position=789; Antisense; AAGGAACTAACACGCTTCTCGAATC
>probe:Drosophila_2:1623894_a_at:448:241; Interrogation_Position=826; Antisense; AATACGATGTGGTGCCGGCGGCCAA
>probe:Drosophila_2:1623894_a_at:555:447; Interrogation_Position=861; Antisense; GATGCCACGCCCAAATACACTTTTG
>probe:Drosophila_2:1623894_a_at:655:533; Interrogation_Position=896; Antisense; GGTCGCGTTGAAAACCTTCCAGATA
>probe:Drosophila_2:1623894_a_at:165:457; Interrogation_Position=917; Antisense; GATACCAGCTCCTAATGTCTACAAA
>probe:Drosophila_2:1623894_a_at:231:163; Interrogation_Position=940; Antisense; AAATACCGACCGTCATGGGCAGCAG
>probe:Drosophila_2:1623894_a_at:615:79; Interrogation_Position=970; Antisense; AGGGCAAGATTCGTTCGGCTCCGGC
>probe:Drosophila_2:1623894_a_at:350:569; Interrogation_Position=986; Antisense; GGCTCCGGCTTATACGATTACGGGT

Paste this into a BLAST search page for me
AAGCCTCCGCTGATTCCGGTGATGAACTACGACGGCGAGTACACGGTGGTAGTCTTCTCCATGCGCGGCAAGTACGTACTGGGAGAAACGTTCGCCTCCTAGAAACCATTGCCAGTCAACGTTCCGTTGTGTTCGCTCTTTGTTGGAGAAAAGGAACTAACACGCTTCTCGAATCAATACGATGTGGTGCCGGCGGCCAAGATGCCACGCCCAAATACACTTTTGGGTCGCGTTGAAAACCTTCCAGATAGATACCAGCTCCTAATGTCTACAAAAAATACCGACCGTCATGGGCAGCAGAGGGCAAGATTCGTTCGGCTCCGGCGGCTCCGGCTTATACGATTACGGGT

Full Affymetrix probeset data:

Annotations for 1623894_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime