FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623895_at:

>probe:Drosophila_2:1623895_at:316:77; Interrogation_Position=1016; Antisense; AGGATCTGCGTTGGCATTGACCAGC
>probe:Drosophila_2:1623895_at:685:699; Interrogation_Position=1044; Antisense; TTTTCCTCGGACTCGAAGATCTCGG
>probe:Drosophila_2:1623895_at:385:39; Interrogation_Position=1062; Antisense; ATCTCGGCCACCTGCTAAAGAGGAA
>probe:Drosophila_2:1623895_at:258:475; Interrogation_Position=1094; Antisense; GTTAGTTCCAAAGTTCGCTTGAGCA
>probe:Drosophila_2:1623895_at:50:107; Interrogation_Position=540; Antisense; AGACACTCTCGCAGATACCGGATCG
>probe:Drosophila_2:1623895_at:571:673; Interrogation_Position=555; Antisense; TACCGGATCGAGTCCAGAGTGGGCT
>probe:Drosophila_2:1623895_at:418:187; Interrogation_Position=636; Antisense; AACAGCGGCACCAGGTTGTCCAGGA
>probe:Drosophila_2:1623895_at:296:723; Interrogation_Position=651; Antisense; TTGTCCAGGAACGTGTAGTCCGCGT
>probe:Drosophila_2:1623895_at:379:521; Interrogation_Position=686; Antisense; GGTGATCGACTCATGGCACTTGATG
>probe:Drosophila_2:1623895_at:462:219; Interrogation_Position=750; Antisense; AAGTCGCCACGCTGCAAGGTCTGTT
>probe:Drosophila_2:1623895_at:479:499; Interrogation_Position=782; Antisense; GTCGTGGTCGAAGCAGTTGATCAAC
>probe:Drosophila_2:1623895_at:113:713; Interrogation_Position=831; Antisense; TTCTCATCGCCTGTGACTATGTAGC
>probe:Drosophila_2:1623895_at:688:495; Interrogation_Position=860; Antisense; GTCAGACTGGCTATTGTTCACCTCG
>probe:Drosophila_2:1623895_at:426:229; Interrogation_Position=902; Antisense; AATGTTTCCTATCACCTGGGAGGGA

Paste this into a BLAST search page for me
AGGATCTGCGTTGGCATTGACCAGCTTTTCCTCGGACTCGAAGATCTCGGATCTCGGCCACCTGCTAAAGAGGAAGTTAGTTCCAAAGTTCGCTTGAGCAAGACACTCTCGCAGATACCGGATCGTACCGGATCGAGTCCAGAGTGGGCTAACAGCGGCACCAGGTTGTCCAGGATTGTCCAGGAACGTGTAGTCCGCGTGGTGATCGACTCATGGCACTTGATGAAGTCGCCACGCTGCAAGGTCTGTTGTCGTGGTCGAAGCAGTTGATCAACTTCTCATCGCCTGTGACTATGTAGCGTCAGACTGGCTATTGTTCACCTCGAATGTTTCCTATCACCTGGGAGGGA

Full Affymetrix probeset data:

Annotations for 1623895_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720