FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623899_at:

>probe:Drosophila_2:1623899_at:59:409; Interrogation_Position=2300; Antisense; GACGACAAAACCTGGCTCTAAGCTA
>probe:Drosophila_2:1623899_at:81:337; Interrogation_Position=2314; Antisense; GCTCTAAGCTACTTTAAGGTCTCGA
>probe:Drosophila_2:1623899_at:575:709; Interrogation_Position=2350; Antisense; TTCAAAGGTCCTTCGACTGGATGCC
>probe:Drosophila_2:1623899_at:580:479; Interrogation_Position=2379; Antisense; GTTTCGCCCTAGTCTAAACTTCAAT
>probe:Drosophila_2:1623899_at:611:577; Interrogation_Position=2456; Antisense; GGCCCCTCGAGCATATCGGATATAG
>probe:Drosophila_2:1623899_at:332:573; Interrogation_Position=2484; Antisense; GGCTGAAAATCCACCCACTAATTGG
>probe:Drosophila_2:1623899_at:66:531; Interrogation_Position=2507; Antisense; GGGTTTCCAATCACAATGGCTCACT
>probe:Drosophila_2:1623899_at:152:281; Interrogation_Position=2526; Antisense; CTCACTGTATATCTGCATTGCCCAA
>probe:Drosophila_2:1623899_at:49:175; Interrogation_Position=2554; Antisense; AAACTCGATACCTTGTTGGGACTCA
>probe:Drosophila_2:1623899_at:228:85; Interrogation_Position=2625; Antisense; AGTGCTATGTAAGATTCCCCATCCT
>probe:Drosophila_2:1623899_at:132:575; Interrogation_Position=2665; Antisense; GGCGGCTACTGATCCATTTGAATCG
>probe:Drosophila_2:1623899_at:405:643; Interrogation_Position=2736; Antisense; TCTTAATTCTCAACGCTTACGGCTG
>probe:Drosophila_2:1623899_at:301:277; Interrogation_Position=2751; Antisense; CTTACGGCTGCTTGCTTAAGTTGCA
>probe:Drosophila_2:1623899_at:279:365; Interrogation_Position=2871; Antisense; GAATAAAGCGACTTGCTCCATCACC

Paste this into a BLAST search page for me
GACGACAAAACCTGGCTCTAAGCTAGCTCTAAGCTACTTTAAGGTCTCGATTCAAAGGTCCTTCGACTGGATGCCGTTTCGCCCTAGTCTAAACTTCAATGGCCCCTCGAGCATATCGGATATAGGGCTGAAAATCCACCCACTAATTGGGGGTTTCCAATCACAATGGCTCACTCTCACTGTATATCTGCATTGCCCAAAAACTCGATACCTTGTTGGGACTCAAGTGCTATGTAAGATTCCCCATCCTGGCGGCTACTGATCCATTTGAATCGTCTTAATTCTCAACGCTTACGGCTGCTTACGGCTGCTTGCTTAAGTTGCAGAATAAAGCGACTTGCTCCATCACC

Full Affymetrix probeset data:

Annotations for 1623899_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720