Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623901_s_at:

>probe:Drosophila_2:1623901_s_at:596:371; Interrogation_Position=428; Antisense; GAAGGACTACTTCCCTGCTGTGGAC
>probe:Drosophila_2:1623901_s_at:35:555; Interrogation_Position=449; Antisense; GGACGCCATCGTTTTCTTAATAGAC
>probe:Drosophila_2:1623901_s_at:534:705; Interrogation_Position=465; Antisense; TTAATAGACGCCTGGGACCGTGGCC
>probe:Drosophila_2:1623901_s_at:170:121; Interrogation_Position=511; Antisense; AGCTGGATTCGCTGCTCACGGATGA
>probe:Drosophila_2:1623901_s_at:323:177; Interrogation_Position=614; Antisense; AAACGTGTTCGGACTGTATCAGCTA
>probe:Drosophila_2:1623901_s_at:184:483; Interrogation_Position=629; Antisense; GTATCAGCTAACAACCGGCAAGGGC
>probe:Drosophila_2:1623901_s_at:32:81; Interrogation_Position=649; Antisense; AGGGCAAAGTTGCACGCGCCGATTT
>probe:Drosophila_2:1623901_s_at:84:579; Interrogation_Position=678; Antisense; GGCCGTCCTCTGGAATTGTTCATGT
>probe:Drosophila_2:1623901_s_at:301:247; Interrogation_Position=691; Antisense; AATTGTTCATGTGCTCCGTGCTGAA
>probe:Drosophila_2:1623901_s_at:271:467; Interrogation_Position=742; Antisense; GTTGGCTGGCGCAGTATATCGATTA
>probe:Drosophila_2:1623901_s_at:661:709; Interrogation_Position=764; Antisense; TTAAGTCAGCATTAGCAACCACCAC
>probe:Drosophila_2:1623901_s_at:220:129; Interrogation_Position=784; Antisense; ACCACCAGCACCATATTTTCAAGAA
>probe:Drosophila_2:1623901_s_at:440:547; Interrogation_Position=891; Antisense; GGATGTGAACCCAGCCCAATTCAAA
>probe:Drosophila_2:1623901_s_at:150:337; Interrogation_Position=940; Antisense; GCTGCGTGCGCAATTTCTAATTTAT

Paste this into a BLAST search page for me
GAAGGACTACTTCCCTGCTGTGGACGGACGCCATCGTTTTCTTAATAGACTTAATAGACGCCTGGGACCGTGGCCAGCTGGATTCGCTGCTCACGGATGAAAACGTGTTCGGACTGTATCAGCTAGTATCAGCTAACAACCGGCAAGGGCAGGGCAAAGTTGCACGCGCCGATTTGGCCGTCCTCTGGAATTGTTCATGTAATTGTTCATGTGCTCCGTGCTGAAGTTGGCTGGCGCAGTATATCGATTATTAAGTCAGCATTAGCAACCACCACACCACCAGCACCATATTTTCAAGAAGGATGTGAACCCAGCCCAATTCAAAGCTGCGTGCGCAATTTCTAATTTAT

Full Affymetrix probeset data:

Annotations for 1623901_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime