FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623902_at:

>probe:Drosophila_2:1623902_at:597:511; Interrogation_Position=163; Antisense; GTGACCAGGGCATTGTGCGCCTGAA
>probe:Drosophila_2:1623902_at:675:323; Interrogation_Position=226; Antisense; GCGACAGTAACACCCGAGAGGCGAT
>probe:Drosophila_2:1623902_at:147:427; Interrogation_Position=241; Antisense; GAGAGGCGATCCACAGCTACGAGCG
>probe:Drosophila_2:1623902_at:41:157; Interrogation_Position=253; Antisense; ACAGCTACGAGCGTGTGCGCAACGA
>probe:Drosophila_2:1623902_at:659:443; Interrogation_Position=285; Antisense; GATGAGCTGGAACCTGGTCCACAAA
>probe:Drosophila_2:1623902_at:472:533; Interrogation_Position=300; Antisense; GGTCCACAAAGGTCCGTCGAGGGCT
>probe:Drosophila_2:1623902_at:218:637; Interrogation_Position=316; Antisense; TCGAGGGCTGGATACTGTTTGTCAC
>probe:Drosophila_2:1623902_at:365:481; Interrogation_Position=332; Antisense; GTTTGTCACCTCTATCCATGAGGAG
>probe:Drosophila_2:1623902_at:407:635; Interrogation_Position=424; Antisense; TCGACCGGCGTACTGGGTTCTCAAA
>probe:Drosophila_2:1623902_at:398:541; Interrogation_Position=439; Antisense; GGTTCTCAAAGGGATACGCTCTCGT
>probe:Drosophila_2:1623902_at:711:637; Interrogation_Position=460; Antisense; TCGTCGAGTACGAGACCCACAAGCA
>probe:Drosophila_2:1623902_at:160:213; Interrogation_Position=499; Antisense; AAGAGGCCCTGAACGGTGCCGAAAT
>probe:Drosophila_2:1623902_at:352:647; Interrogation_Position=539; Antisense; TCAGGTTGACTGGTGCTTCGTTAAG
>probe:Drosophila_2:1623902_at:43:405; Interrogation_Position=608; Antisense; GACTCCCAGCCCCAAGAATAATTTT

Paste this into a BLAST search page for me
GTGACCAGGGCATTGTGCGCCTGAAGCGACAGTAACACCCGAGAGGCGATGAGAGGCGATCCACAGCTACGAGCGACAGCTACGAGCGTGTGCGCAACGAGATGAGCTGGAACCTGGTCCACAAAGGTCCACAAAGGTCCGTCGAGGGCTTCGAGGGCTGGATACTGTTTGTCACGTTTGTCACCTCTATCCATGAGGAGTCGACCGGCGTACTGGGTTCTCAAAGGTTCTCAAAGGGATACGCTCTCGTTCGTCGAGTACGAGACCCACAAGCAAAGAGGCCCTGAACGGTGCCGAAATTCAGGTTGACTGGTGCTTCGTTAAGGACTCCCAGCCCCAAGAATAATTTT

Full Affymetrix probeset data:

Annotations for 1623902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720