FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623903_at:

>probe:Drosophila_2:1623903_at:673:179; Interrogation_Position=1031; Antisense; AAACATCGATTGACCTCCTATGGCG
>probe:Drosophila_2:1623903_at:459:625; Interrogation_Position=1089; Antisense; TGCCCAGAATGTTCGATCGCGGAGT
>probe:Drosophila_2:1623903_at:546:611; Interrogation_Position=1137; Antisense; TGACGGTCACCAATCCTGCAAAATG
>probe:Drosophila_2:1623903_at:133:477; Interrogation_Position=1194; Antisense; GTTATTCTGGTAGCATCTCTTATCA
>probe:Drosophila_2:1623903_at:643:95; Interrogation_Position=1236; Antisense; AGATTAGCGCGGTTCTTTTGGCAAT
>probe:Drosophila_2:1623903_at:277:229; Interrogation_Position=1265; Antisense; AATGGGCGTGTCTTCGAACTCAAGC
>probe:Drosophila_2:1623903_at:629:331; Interrogation_Position=711; Antisense; GCTGTGGTGTTTCTATGCATCCGCA
>probe:Drosophila_2:1623903_at:199:227; Interrogation_Position=746; Antisense; AAGGCTCCTTTTGAGATCATGCGTC
>probe:Drosophila_2:1623903_at:369:35; Interrogation_Position=761; Antisense; ATCATGCGTCTTTACTTGGAGGCGG
>probe:Drosophila_2:1623903_at:231:497; Interrogation_Position=806; Antisense; GTCATGTCGCATTTGGATCGCACCA
>probe:Drosophila_2:1623903_at:155:451; Interrogation_Position=821; Antisense; GATCGCACCATTTTCGACATCGATG
>probe:Drosophila_2:1623903_at:224:445; Interrogation_Position=842; Antisense; GATGAGCTGCTGGAATTCGCCAAGC
>probe:Drosophila_2:1623903_at:288:335; Interrogation_Position=870; Antisense; GCTGCTACATTCAGTACGATCTCTT
>probe:Drosophila_2:1623903_at:424:433; Interrogation_Position=902; Antisense; GAGTGCTCCTTCTATCAACTGAATA

Paste this into a BLAST search page for me
AAACATCGATTGACCTCCTATGGCGTGCCCAGAATGTTCGATCGCGGAGTTGACGGTCACCAATCCTGCAAAATGGTTATTCTGGTAGCATCTCTTATCAAGATTAGCGCGGTTCTTTTGGCAATAATGGGCGTGTCTTCGAACTCAAGCGCTGTGGTGTTTCTATGCATCCGCAAAGGCTCCTTTTGAGATCATGCGTCATCATGCGTCTTTACTTGGAGGCGGGTCATGTCGCATTTGGATCGCACCAGATCGCACCATTTTCGACATCGATGGATGAGCTGCTGGAATTCGCCAAGCGCTGCTACATTCAGTACGATCTCTTGAGTGCTCCTTCTATCAACTGAATA

Full Affymetrix probeset data:

Annotations for 1623903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720