Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623907_at:

>probe:Drosophila_2:1623907_at:200:185; Interrogation_Position=3419; Antisense; AAAAGGATATCCCTCAAGCGCACGG
>probe:Drosophila_2:1623907_at:567:311; Interrogation_Position=3438; Antisense; GCACGGCACGTTCTTTTACGGAATC
>probe:Drosophila_2:1623907_at:463:549; Interrogation_Position=3522; Antisense; GGAGGTGTTCCTAATGACCATCGCC
>probe:Drosophila_2:1623907_at:362:291; Interrogation_Position=3553; Antisense; CGTGCCAATGTGACTGCCGATCAGA
>probe:Drosophila_2:1623907_at:405:97; Interrogation_Position=3575; Antisense; AGATCGGTATAATCACGCCCTATCA
>probe:Drosophila_2:1623907_at:217:431; Interrogation_Position=3621; Antisense; GAGTATGTTCATTGGCACCGACGTG
>probe:Drosophila_2:1623907_at:74:243; Interrogation_Position=3705; Antisense; AATATCCACGGTGCGTTCATCAGAA
>probe:Drosophila_2:1623907_at:238:715; Interrogation_Position=3754; Antisense; TTCTCCTTGGGATTCGTGCGTTGCA
>probe:Drosophila_2:1623907_at:69:111; Interrogation_Position=3778; Antisense; AGCAAGCGACTTAACGTGGCCGTTT
>probe:Drosophila_2:1623907_at:554:605; Interrogation_Position=3818; Antisense; TGATGATCATCTTCGGGAATCCCCA
>probe:Drosophila_2:1623907_at:262:313; Interrogation_Position=3869; Antisense; GCCAGCTAATCCTGTTCTGTGTCAA
>probe:Drosophila_2:1623907_at:369:333; Interrogation_Position=3911; Antisense; GCTGTGATCTGCCTCAAATGGTGAT
>probe:Drosophila_2:1623907_at:125:435; Interrogation_Position=3949; Antisense; GAGGTCCCCGTTTGCTTGGAAACAT
>probe:Drosophila_2:1623907_at:688:559; Interrogation_Position=3966; Antisense; GGAAACATTCGTGCCTTCACTGAAT

Paste this into a BLAST search page for me
AAAAGGATATCCCTCAAGCGCACGGGCACGGCACGTTCTTTTACGGAATCGGAGGTGTTCCTAATGACCATCGCCCGTGCCAATGTGACTGCCGATCAGAAGATCGGTATAATCACGCCCTATCAGAGTATGTTCATTGGCACCGACGTGAATATCCACGGTGCGTTCATCAGAATTCTCCTTGGGATTCGTGCGTTGCAAGCAAGCGACTTAACGTGGCCGTTTTGATGATCATCTTCGGGAATCCCCAGCCAGCTAATCCTGTTCTGTGTCAAGCTGTGATCTGCCTCAAATGGTGATGAGGTCCCCGTTTGCTTGGAAACATGGAAACATTCGTGCCTTCACTGAAT

Full Affymetrix probeset data:

Annotations for 1623907_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime