FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623908_at:

>probe:Drosophila_2:1623908_at:324:11; Interrogation_Position=305; Antisense; ATTCGTCAGTCAATCCGTCGTGCTC
>probe:Drosophila_2:1623908_at:194:147; Interrogation_Position=419; Antisense; GCCTATGGAAAAAGTCGCCCCTGCA
>probe:Drosophila_2:1623908_at:545:679; Interrogation_Position=537; Antisense; TAGTGCCCCGCTGTTGTGCAAGTGG
>probe:Drosophila_2:1623908_at:485:323; Interrogation_Position=577; Antisense; GCGCGCCCCAAATGCATCAAAGTAA
>probe:Drosophila_2:1623908_at:79:437; Interrogation_Position=616; Antisense; GAGGAGCAGCTTGTCCTGGTCGAAT
>probe:Drosophila_2:1623908_at:316:425; Interrogation_Position=642; Antisense; GAGAGCGGGAATATCCACATTCACA
>probe:Drosophila_2:1623908_at:400:13; Interrogation_Position=660; Antisense; ATTCACATCCTCATCCAGTCAAATG
>probe:Drosophila_2:1623908_at:615:305; Interrogation_Position=703; Antisense; CCTGCAGTTCTGTCTTCATTCGAAA
>probe:Drosophila_2:1623908_at:271:9; Interrogation_Position=727; Antisense; ATTCCTTCGGGAGTTAAAGCTGTCG
>probe:Drosophila_2:1623908_at:673:371; Interrogation_Position=762; Antisense; GAAGGATCCCGAAAACTCGATTGCG
>probe:Drosophila_2:1623908_at:18:529; Interrogation_Position=787; Antisense; GGGACTTCTATGGTCACCACAAGAG
>probe:Drosophila_2:1623908_at:5:215; Interrogation_Position=807; Antisense; AAGAGTGTATGCTCCCCATGATGGC
>probe:Drosophila_2:1623908_at:149:3; Interrogation_Position=862; Antisense; ATTGTGCGCCATTGTTCACTGGAGC
>probe:Drosophila_2:1623908_at:52:143; Interrogation_Position=879; Antisense; ACTGGAGCCCCATTGTCTAAGCTAA

Paste this into a BLAST search page for me
ATTCGTCAGTCAATCCGTCGTGCTCGCCTATGGAAAAAGTCGCCCCTGCATAGTGCCCCGCTGTTGTGCAAGTGGGCGCGCCCCAAATGCATCAAAGTAAGAGGAGCAGCTTGTCCTGGTCGAATGAGAGCGGGAATATCCACATTCACAATTCACATCCTCATCCAGTCAAATGCCTGCAGTTCTGTCTTCATTCGAAAATTCCTTCGGGAGTTAAAGCTGTCGGAAGGATCCCGAAAACTCGATTGCGGGGACTTCTATGGTCACCACAAGAGAAGAGTGTATGCTCCCCATGATGGCATTGTGCGCCATTGTTCACTGGAGCACTGGAGCCCCATTGTCTAAGCTAA

Full Affymetrix probeset data:

Annotations for 1623908_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720