FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623910_at:

>probe:Drosophila_2:1623910_at:60:85; Interrogation_Position=1023; Antisense; AGTGTGATCCGCGTCGTGGCAAGTA
>probe:Drosophila_2:1623910_at:443:449; Interrogation_Position=1028; Antisense; GATCCGCGTCGTGGCAAGTACATGG
>probe:Drosophila_2:1623910_at:367:251; Interrogation_Position=1087; Antisense; CAAGGATGTGAACGCAGCCATTGCC
>probe:Drosophila_2:1623910_at:305:213; Interrogation_Position=1118; Antisense; AAGACCAAGCGCTCTATCCAGTTCG
>probe:Drosophila_2:1623910_at:481:93; Interrogation_Position=1137; Antisense; AGTTCGTCGACTGGTGTCCCACGGG
>probe:Drosophila_2:1623910_at:7:133; Interrogation_Position=1189; Antisense; ACCCACCGTTGTTCCTGGCGGAGAT
>probe:Drosophila_2:1623910_at:598:509; Interrogation_Position=1223; Antisense; GTGCAGCGCGCCGTCTGCATGCTGT
>probe:Drosophila_2:1623910_at:206:53; Interrogation_Position=1241; Antisense; ATGCTGTCCAATACCACTGCCATTG
>probe:Drosophila_2:1623910_at:362:469; Interrogation_Position=1363; Antisense; GTTCGCCGAGGCTCGCGAGGATCTC
>probe:Drosophila_2:1623910_at:42:75; Interrogation_Position=1410; Antisense; AGGAGGTAGGCATCGACTCCACCAC
>probe:Drosophila_2:1623910_at:552:293; Interrogation_Position=1469; Antisense; CGTTGTCAACAAATGATACAGCCAT
>probe:Drosophila_2:1623910_at:158:457; Interrogation_Position=1483; Antisense; GATACAGCCATTACAACTTTATAAA
>probe:Drosophila_2:1623910_at:580:269; Interrogation_Position=1508; Antisense; CATCACTTTCTTTCTACCAAATACC
>probe:Drosophila_2:1623910_at:166:27; Interrogation_Position=1528; Antisense; ATACCAATGCATAAAACAGTTTCGC

Paste this into a BLAST search page for me
AGTGTGATCCGCGTCGTGGCAAGTAGATCCGCGTCGTGGCAAGTACATGGCAAGGATGTGAACGCAGCCATTGCCAAGACCAAGCGCTCTATCCAGTTCGAGTTCGTCGACTGGTGTCCCACGGGACCCACCGTTGTTCCTGGCGGAGATGTGCAGCGCGCCGTCTGCATGCTGTATGCTGTCCAATACCACTGCCATTGGTTCGCCGAGGCTCGCGAGGATCTCAGGAGGTAGGCATCGACTCCACCACCGTTGTCAACAAATGATACAGCCATGATACAGCCATTACAACTTTATAAACATCACTTTCTTTCTACCAAATACCATACCAATGCATAAAACAGTTTCGC

Full Affymetrix probeset data:

Annotations for 1623910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720